\
| Variant ID: vg1109865508 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 9865508 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 41. )
TGACATGGCGAAGGCGGCTGCGGTGGCAAGGGCACTCCAGACCAAGGCAGAGATCCTTTCGACAAGCCAGCTGCTGGTGCCCCAAGCCGCTCCGTCGCAG[T/C]
CGGCAGCGGCCCCAACTGCGCTCTCCGCTGTGCAAGCCCAAGTCAACCCTGACCCCGAAACACAAACCGAAGCCGACATGGAAGCCATGCGACAGAACAT
ATGTTCTGTCGCATGGCTTCCATGTCGGCTTCGGTTTGTGTTTCGGGGTCAGGGTTGACTTGGGCTTGCACAGCGGAGAGCGCAGTTGGGGCCGCTGCCG[A/G]
CTGCGACGGAGCGGCTTGGGGCACCAGCAGCTGGCTTGTCGAAAGGATCTCTGCCTTGGTCTGGAGTGCCCTTGCCACCGCAGCCGCCTTCGCCATGTCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.00% | 44.60% | 6.16% | 0.23% | NA |
| All Indica | 2759 | 73.80% | 19.50% | 6.71% | 0.04% | NA |
| All Japonica | 1512 | 2.10% | 96.60% | 1.19% | 0.13% | NA |
| Aus | 269 | 72.10% | 17.50% | 10.41% | 0.00% | NA |
| Indica I | 595 | 73.40% | 21.30% | 5.21% | 0.00% | NA |
| Indica II | 465 | 82.40% | 11.60% | 6.02% | 0.00% | NA |
| Indica III | 913 | 73.60% | 18.60% | 7.78% | 0.00% | NA |
| Indica Intermediate | 786 | 69.20% | 23.70% | 7.00% | 0.13% | NA |
| Temperate Japonica | 767 | 2.10% | 96.90% | 1.04% | 0.00% | NA |
| Tropical Japonica | 504 | 2.20% | 96.80% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 95.40% | 2.07% | 0.83% | NA |
| VI/Aromatic | 96 | 14.60% | 22.90% | 55.21% | 7.29% | NA |
| Intermediate | 90 | 44.40% | 46.70% | 7.78% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1109865508 | T -> DEL | LOC_Os11g17670.1 | N | frameshift_variant | Average:14.73; most accessible tissue: Callus, score: 29.289 | N | N | N | N |
| vg1109865508 | T -> C | LOC_Os11g17670.1 | missense_variant ; p.Ser255Pro; MODERATE | nonsynonymous_codon ; S255P | Average:14.73; most accessible tissue: Callus, score: 29.289 | unknown | unknown | TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1109865508 | NA | 1.82E-06 | mr1041_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109865508 | NA | 1.67E-07 | mr1184_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109865508 | NA | 2.77E-06 | mr1293_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109865508 | 3.77E-06 | 9.84E-07 | mr1341_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109865508 | NA | 1.98E-08 | mr1418_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109865508 | NA | 2.26E-06 | mr1419_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109865508 | NA | 1.45E-07 | mr1420_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109865508 | NA | 5.43E-06 | mr1428_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109865508 | NA | 2.63E-07 | mr1467_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109865508 | NA | 1.80E-08 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109865508 | NA | 3.52E-07 | mr1492_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109865508 | NA | 3.31E-06 | mr1508_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109865508 | NA | 3.88E-07 | mr1556_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109865508 | NA | 1.93E-07 | mr1604_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109865508 | NA | 7.66E-06 | mr1759_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109865508 | NA | 9.46E-07 | mr1764_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109865508 | NA | 1.94E-07 | mr1779_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109865508 | NA | 2.57E-06 | mr1811_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109865508 | NA | 8.26E-06 | mr1816_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109865508 | NA | 7.64E-06 | mr1832_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109865508 | NA | 1.02E-07 | mr1992_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |