\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109811763:

Variant ID: vg1109811763 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 9811763
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


ACGCCTCTCCTTTCTTGATGTCTACCATTCCTCAAGTTAACTGTTAACATCTGATGCTGTAGTTCCCAGCATCTCCTCCTGTGTCACGCCCTGAAGTTCC[C/T]
CTCCTTGCTTTAAAATTCATAAAATAAATCGTCCGAAGAAATGATTTAATTTAACCTAGAGCTAACTCCTCAAATTAATAAATGCAAATAATAATCGGAA

Reverse complement sequence

TTCCGATTATTATTTGCATTTATTAATTTGAGGAGTTAGCTCTAGGTTAAATTAAATCATTTCTTCGGACGATTTATTTTATGAATTTTAAAGCAAGGAG[G/A]
GGAACTTCAGGGCGTGACACAGGAGGAGATGCTGGGAACTACAGCATCAGATGTTAACAGTTAACTTGAGGAATGGTAGACATCAAGAAAGGAGAGGCGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.00% 17.50% 0.21% 44.27% NA
All Indica  2759 8.60% 29.50% 0.29% 61.65% NA
All Japonica  1512 96.60% 0.30% 0.00% 3.11% NA
Aus  269 16.00% 0.70% 0.00% 83.27% NA
Indica I  595 7.40% 63.50% 0.34% 28.74% NA
Indica II  465 1.50% 3.40% 0.22% 94.84% NA
Indica III  913 10.80% 27.60% 0.22% 61.34% NA
Indica Intermediate  786 11.10% 21.20% 0.38% 67.30% NA
Temperate Japonica  767 97.00% 0.00% 0.00% 3.00% NA
Tropical Japonica  504 96.60% 0.80% 0.00% 2.58% NA
Japonica Intermediate  241 95.00% 0.40% 0.00% 4.56% NA
VI/Aromatic  96 20.80% 1.00% 0.00% 78.12% NA
Intermediate  90 41.10% 6.70% 2.22% 50.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1109811763 C -> T LOC_Os11g17600.1 downstream_gene_variant ; 4118.0bp to feature; MODIFIER silent_mutation Average:73.151; most accessible tissue: Callus, score: 88.246 N N N N
vg1109811763 C -> T LOC_Os11g17610.1 downstream_gene_variant ; 4144.0bp to feature; MODIFIER silent_mutation Average:73.151; most accessible tissue: Callus, score: 88.246 N N N N
vg1109811763 C -> T LOC_Os11g17600.3 downstream_gene_variant ; 1725.0bp to feature; MODIFIER silent_mutation Average:73.151; most accessible tissue: Callus, score: 88.246 N N N N
vg1109811763 C -> T LOC_Os11g17600.2 downstream_gene_variant ; 1494.0bp to feature; MODIFIER silent_mutation Average:73.151; most accessible tissue: Callus, score: 88.246 N N N N
vg1109811763 C -> T LOC_Os11g17600-LOC_Os11g17610 intergenic_region ; MODIFIER silent_mutation Average:73.151; most accessible tissue: Callus, score: 88.246 N N N N
vg1109811763 C -> DEL N N silent_mutation Average:73.151; most accessible tissue: Callus, score: 88.246 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1109811763 NA 1.00E-05 mr1679 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109811763 NA 1.08E-06 mr1693 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109811763 NA 4.09E-06 mr1679_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109811763 NA 2.52E-06 mr1691_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109811763 3.26E-06 NA mr1728_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251