Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1109811763:

Variant ID: vg1109811763 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 9811763
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

ACGCCTCTCCTTTCTTGATGTCTACCATTCCTCAAGTTAACTGTTAACATCTGATGCTGTAGTTCCCAGCATCTCCTCCTGTGTCACGCCCTGAAGTTCC[C/T]
CTCCTTGCTTTAAAATTCATAAAATAAATCGTCCGAAGAAATGATTTAATTTAACCTAGAGCTAACTCCTCAAATTAATAAATGCAAATAATAATCGGAA

Reverse complement sequence

TTCCGATTATTATTTGCATTTATTAATTTGAGGAGTTAGCTCTAGGTTAAATTAAATCATTTCTTCGGACGATTTATTTTATGAATTTTAAAGCAAGGAG[G/A]
GGAACTTCAGGGCGTGACACAGGAGGAGATGCTGGGAACTACAGCATCAGATGTTAACAGTTAACTTGAGGAATGGTAGACATCAAGAAAGGAGAGGCGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.00%	17.50%	0.21%	44.27%	NA
All Indica	2759	8.60%	29.50%	0.29%	61.65%	NA
All Japonica	1512	96.60%	0.30%	0.00%	3.11%	NA
Aus	269	16.00%	0.70%	0.00%	83.27%	NA
Indica I	595	7.40%	63.50%	0.34%	28.74%	NA
Indica II	465	1.50%	3.40%	0.22%	94.84%	NA
Indica III	913	10.80%	27.60%	0.22%	61.34%	NA
Indica Intermediate	786	11.10%	21.20%	0.38%	67.30%	NA
Temperate Japonica	767	97.00%	0.00%	0.00%	3.00%	NA
Tropical Japonica	504	96.60%	0.80%	0.00%	2.58%	NA
Japonica Intermediate	241	95.00%	0.40%	0.00%	4.56%	NA
VI/Aromatic	96	20.80%	1.00%	0.00%	78.12%	NA
Intermediate	90	41.10%	6.70%	2.22%	50.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1109811763	C -> T	LOC_Os11g17600.1	downstream_gene_variant ; 4118.0bp to feature; MODIFIER	silent_mutation	Average:73.151; most accessible tissue: Callus, score: 88.246	N	N	N	N
vg1109811763	C -> T	LOC_Os11g17610.1	downstream_gene_variant ; 4144.0bp to feature; MODIFIER	silent_mutation	Average:73.151; most accessible tissue: Callus, score: 88.246	N	N	N	N
vg1109811763	C -> T	LOC_Os11g17600.3	downstream_gene_variant ; 1725.0bp to feature; MODIFIER	silent_mutation	Average:73.151; most accessible tissue: Callus, score: 88.246	N	N	N	N
vg1109811763	C -> T	LOC_Os11g17600.2	downstream_gene_variant ; 1494.0bp to feature; MODIFIER	silent_mutation	Average:73.151; most accessible tissue: Callus, score: 88.246	N	N	N	N
vg1109811763	C -> T	LOC_Os11g17600-LOC_Os11g17610	intergenic_region ; MODIFIER	silent_mutation	Average:73.151; most accessible tissue: Callus, score: 88.246	N	N	N	N
vg1109811763	C -> DEL	N	N	silent_mutation	Average:73.151; most accessible tissue: Callus, score: 88.246	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1109811763	NA	1.00E-05	mr1679	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109811763	NA	1.08E-06	mr1693	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109811763	NA	4.09E-06	mr1679_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109811763	NA	2.52E-06	mr1691_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109811763	3.26E-06	NA	mr1728_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251