\
| Variant ID: vg1109790194 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 9790194 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 245. )
ACCAACGATCCCCATACTATGCAAATACCAGAATTGCGACATCAAACGTCGACAGTGGCGCGCCAGGTAGGGGATCTTTTGGTGCTTCAAGGTTTCGACG[G/A]
GATGGGTTTAAGAGATGGATTCTCCGACAATATACTACTCGATAACTTCGGCTATGGAGGATCTAACCTGACCGGAGTACGTGCCCTGACAAGATCGGAA
TTCCGATCTTGTCAGGGCACGTACTCCGGTCAGGTTAGATCCTCCATAGCCGAAGTTATCGAGTAGTATATTGTCGGAGAATCCATCTCTTAAACCCATC[C/T]
CGTCGAAACCTTGAAGCACCAAAAGATCCCCTACCTGGCGCGCCACTGTCGACGTTTGATGTCGCAATTCTGGTATTTGCATAGTATGGGGATCGTTGGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.90% | 32.00% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 99.00% | 1.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 4.70% | 95.20% | 0.13% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.50% | 1.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 3.50% | 96.20% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 5.40% | 94.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 81.20% | 18.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 31.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1109790194 | G -> A | LOC_Os11g17580.1 | upstream_gene_variant ; 1480.0bp to feature; MODIFIER | silent_mutation | Average:35.487; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 | N | N | N | N |
| vg1109790194 | G -> A | LOC_Os11g17600.1 | upstream_gene_variant ; 4714.0bp to feature; MODIFIER | silent_mutation | Average:35.487; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 | N | N | N | N |
| vg1109790194 | G -> A | LOC_Os11g17600.3 | upstream_gene_variant ; 4714.0bp to feature; MODIFIER | silent_mutation | Average:35.487; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 | N | N | N | N |
| vg1109790194 | G -> A | LOC_Os11g17600.2 | upstream_gene_variant ; 4714.0bp to feature; MODIFIER | silent_mutation | Average:35.487; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 | N | N | N | N |
| vg1109790194 | G -> A | LOC_Os11g17570.1 | downstream_gene_variant ; 4693.0bp to feature; MODIFIER | silent_mutation | Average:35.487; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 | N | N | N | N |
| vg1109790194 | G -> A | LOC_Os11g17580-LOC_Os11g17600 | intergenic_region ; MODIFIER | silent_mutation | Average:35.487; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1109790194 | NA | 2.63E-09 | mr1005 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109790194 | NA | 5.38E-17 | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109790194 | NA | 8.73E-22 | mr1122 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109790194 | NA | 1.82E-22 | mr1168 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109790194 | NA | 1.04E-43 | mr1194 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109790194 | NA | 2.45E-09 | mr1336 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109790194 | NA | 3.53E-14 | mr1361 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109790194 | NA | 9.09E-24 | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109790194 | NA | 1.20E-13 | mr1653 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109790194 | NA | 1.58E-13 | mr1701 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109790194 | NA | 3.29E-96 | mr1758 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109790194 | NA | 7.71E-19 | mr1767 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109790194 | NA | 8.50E-37 | mr1882 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109790194 | NA | 2.53E-06 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109790194 | NA | 1.63E-14 | mr1162_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109790194 | NA | 3.46E-19 | mr1168_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109790194 | NA | 6.87E-35 | mr1223_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109790194 | NA | 9.96E-137 | mr1758_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109790194 | NA | 5.80E-15 | mr1767_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |