Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109790194:

Variant ID: vg1109790194 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 9790194
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

ACCAACGATCCCCATACTATGCAAATACCAGAATTGCGACATCAAACGTCGACAGTGGCGCGCCAGGTAGGGGATCTTTTGGTGCTTCAAGGTTTCGACG[G/A]
GATGGGTTTAAGAGATGGATTCTCCGACAATATACTACTCGATAACTTCGGCTATGGAGGATCTAACCTGACCGGAGTACGTGCCCTGACAAGATCGGAA

Reverse complement sequence

TTCCGATCTTGTCAGGGCACGTACTCCGGTCAGGTTAGATCCTCCATAGCCGAAGTTATCGAGTAGTATATTGTCGGAGAATCCATCTCTTAAACCCATC[C/T]
CGTCGAAACCTTGAAGCACCAAAAGATCCCCTACCTGGCGCGCCACTGTCGACGTTTGATGTCGCAATTCTGGTATTTGCATAGTATGGGGATCGTTGGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.90%	32.00%	0.06%	0.00%	NA
All Indica	2759	99.00%	1.00%	0.04%	0.00%	NA
All Japonica	1512	4.70%	95.20%	0.13%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	98.50%	1.30%	0.17%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	98.10%	1.90%	0.00%	0.00%	NA
Temperate Japonica	767	3.50%	96.20%	0.26%	0.00%	NA
Tropical Japonica	504	6.20%	93.80%	0.00%	0.00%	NA
Japonica Intermediate	241	5.40%	94.60%	0.00%	0.00%	NA
VI/Aromatic	96	81.20%	18.80%	0.00%	0.00%	NA
Intermediate	90	68.90%	31.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1109790194	G -> A	LOC_Os11g17580.1	upstream_gene_variant ; 1480.0bp to feature; MODIFIER	silent_mutation	Average:35.487; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N
vg1109790194	G -> A	LOC_Os11g17600.1	upstream_gene_variant ; 4714.0bp to feature; MODIFIER	silent_mutation	Average:35.487; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N
vg1109790194	G -> A	LOC_Os11g17600.3	upstream_gene_variant ; 4714.0bp to feature; MODIFIER	silent_mutation	Average:35.487; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N
vg1109790194	G -> A	LOC_Os11g17600.2	upstream_gene_variant ; 4714.0bp to feature; MODIFIER	silent_mutation	Average:35.487; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N
vg1109790194	G -> A	LOC_Os11g17570.1	downstream_gene_variant ; 4693.0bp to feature; MODIFIER	silent_mutation	Average:35.487; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N
vg1109790194	G -> A	LOC_Os11g17580-LOC_Os11g17600	intergenic_region ; MODIFIER	silent_mutation	Average:35.487; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1109790194	NA	2.63E-09	mr1005	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109790194	NA	5.38E-17	mr1116	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109790194	NA	8.73E-22	mr1122	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109790194	NA	1.82E-22	mr1168	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109790194	NA	1.04E-43	mr1194	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109790194	NA	2.45E-09	mr1336	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109790194	NA	3.53E-14	mr1361	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109790194	NA	9.09E-24	mr1383	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109790194	NA	1.20E-13	mr1653	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109790194	NA	1.58E-13	mr1701	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109790194	NA	3.29E-96	mr1758	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109790194	NA	7.71E-19	mr1767	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109790194	NA	8.50E-37	mr1882	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109790194	NA	2.53E-06	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109790194	NA	1.63E-14	mr1162_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109790194	NA	3.46E-19	mr1168_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109790194	NA	6.87E-35	mr1223_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109790194	NA	9.96E-137	mr1758_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109790194	NA	5.80E-15	mr1767_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251