| Variant ID: vg1109710245 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 9710245 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTTCGAGTTGGACTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCACGCCATTATACTATGGCGCAAGCAGTACATCATCCTCCCTGGG[C/T]
GACAAGCGGCGTCTCGTGCACCATCTCCTCCTCAGGCTCCAGCACCGTCTCTACCTCAGGCTCCTGCACCGACTCCTCATCAGGCTCCTGCACCGACTCT
AGAGTCGGTGCAGGAGCCTGATGAGGAGTCGGTGCAGGAGCCTGAGGTAGAGACGGTGCTGGAGCCTGAGGAGGAGATGGTGCACGAGACGCCGCTTGTC[G/A]
CCCAGGGAGGATGATGTACTGCTTGCGCCATAGTATAATGGCGTGGCTTGTGTCTCGTAGATGCGTCTCACCGTCTCCTCCAGGGTAGTCCAACTCGAAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.80% | 9.20% | 0.55% | 3.41% | NA |
| All Indica | 2759 | 78.10% | 15.60% | 0.94% | 5.36% | NA |
| All Japonica | 1512 | 99.30% | 0.10% | 0.00% | 0.66% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 84.50% | 11.10% | 0.50% | 3.87% | NA |
| Indica II | 465 | 90.80% | 1.70% | 1.29% | 6.24% | NA |
| Indica III | 913 | 67.40% | 29.60% | 0.88% | 2.19% | NA |
| Indica Intermediate | 786 | 78.10% | 11.10% | 1.15% | 9.67% | NA |
| Temperate Japonica | 767 | 98.70% | 0.00% | 0.00% | 1.30% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 96.70% | 2.20% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1109710245 | C -> T | LOC_Os11g17410.1 | stop_gained ; p.Arg229*; HIGH | stop_gained | Average:28.115; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 | N | N | N | N |
| vg1109710245 | C -> DEL | LOC_Os11g17410.1 | N | frameshift_variant | Average:28.115; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1109710245 | NA | 2.62E-07 | Grain_weight | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1109710245 | 6.01E-06 | 2.18E-06 | mr1134 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109710245 | 4.09E-06 | 6.68E-07 | mr1135 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109710245 | NA | 6.01E-07 | mr1504 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109710245 | NA | 2.84E-06 | mr1517 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109710245 | NA | 9.10E-07 | mr1672 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109710245 | NA | 9.78E-06 | mr1672_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |