\
| Variant ID: vg1109530380 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 9530380 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 66. )
TCAATACCTCCTATCTCCCTCTGCATGGTCCCGCGGCCAGGGAGGGTGCCGTCGTCCTGCAACTTCTTCAGGGATGCGGTGGTGGAGGTGGACTTGTCGA[T/G]
ATCCATCGCCGCCGGAGGATCGCCGGAGAGTAAAGCGAAAGAGGCAAGCTAGGGTTTTCCCTACGGGAGCGGAGATGACGAAGGGCGCTTGAAGACTTGA
TCAAGTCTTCAAGCGCCCTTCGTCATCTCCGCTCCCGTAGGGAAAACCCTAGCTTGCCTCTTTCGCTTTACTCTCCGGCGATCCTCCGGCGGCGATGGAT[A/C]
TCGACAAGTCCACCTCCACCACCGCATCCCTGAAGAAGTTGCAGGACGACGGCACCCTCCCTGGCCGCGGGACCATGCAGAGGGAGATAGGAGGTATTGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.00% | 14.50% | 3.72% | 46.76% | NA |
| All Indica | 2759 | 4.90% | 24.70% | 6.02% | 64.41% | NA |
| All Japonica | 1512 | 96.00% | 0.10% | 0.13% | 3.84% | NA |
| Aus | 269 | 4.50% | 0.00% | 2.60% | 92.94% | NA |
| Indica I | 595 | 8.90% | 15.60% | 3.53% | 71.93% | NA |
| Indica II | 465 | 3.40% | 17.40% | 4.30% | 74.84% | NA |
| Indica III | 913 | 1.80% | 38.70% | 8.98% | 50.60% | NA |
| Indica Intermediate | 786 | 6.20% | 19.70% | 5.47% | 68.58% | NA |
| Temperate Japonica | 767 | 97.10% | 0.10% | 0.00% | 2.74% | NA |
| Tropical Japonica | 504 | 94.60% | 0.00% | 0.40% | 4.96% | NA |
| Japonica Intermediate | 241 | 95.00% | 0.00% | 0.00% | 4.98% | NA |
| VI/Aromatic | 96 | 18.80% | 0.00% | 0.00% | 81.25% | NA |
| Intermediate | 90 | 44.40% | 2.20% | 1.11% | 52.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1109530380 | T -> DEL | LOC_Os11g17160.1 | N | frameshift_variant | Average:18.018; most accessible tissue: Minghui63 root, score: 35.002 | N | N | N | N |
| vg1109530380 | T -> G | LOC_Os11g17160.1 | missense_variant ; p.Ile3Leu; MODERATE | nonsynonymous_codon ; I3L | Average:18.018; most accessible tissue: Minghui63 root, score: 35.002 | unknown | unknown | TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1109530380 | NA | 2.74E-09 | mr1986 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530380 | 1.96E-06 | 1.96E-06 | mr1025_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530380 | NA | 2.78E-06 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530380 | 3.18E-06 | 6.97E-06 | mr1306_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530380 | NA | 1.53E-07 | mr1376_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530380 | 3.64E-06 | NA | mr1376_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530380 | 6.68E-06 | 1.25E-06 | mr1409_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530380 | NA | 9.06E-08 | mr1431_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530380 | 5.08E-06 | 5.08E-06 | mr1463_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530380 | 3.25E-06 | 5.42E-06 | mr1505_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530380 | NA | 5.36E-06 | mr1649_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530380 | 4.91E-06 | 4.91E-06 | mr1736_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530380 | NA | 8.56E-09 | mr1835_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530380 | 2.46E-06 | 1.98E-06 | mr1849_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |