\
| Variant ID: vg1109530326 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 9530326 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.26, others allele: 0.00, population size: 47. )
CCGCAAGAAATATAATCTTCGACCGTAACCATACGGCCTAAGATGGGTTCGGGTTCAATACCTCCTATCTCCCTCTGCATGGTCCCGCGGCCAGGGAGGG[T/C]
GCCGTCGTCCTGCAACTTCTTCAGGGATGCGGTGGTGGAGGTGGACTTGTCGATATCCATCGCCGCCGGAGGATCGCCGGAGAGTAAAGCGAAAGAGGCA
TGCCTCTTTCGCTTTACTCTCCGGCGATCCTCCGGCGGCGATGGATATCGACAAGTCCACCTCCACCACCGCATCCCTGAAGAAGTTGCAGGACGACGGC[A/G]
CCCTCCCTGGCCGCGGGACCATGCAGAGGGAGATAGGAGGTATTGAACCCGAACCCATCTTAGGCCGTATGGTTACGGTCGAAGATTATATTTCTTGCGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.90% | 14.80% | 4.57% | 45.70% | NA |
| All Indica | 2759 | 5.00% | 24.80% | 6.85% | 63.32% | NA |
| All Japonica | 1512 | 95.50% | 0.30% | 0.40% | 3.77% | NA |
| Aus | 269 | 5.20% | 1.50% | 6.69% | 86.62% | NA |
| Indica I | 595 | 8.70% | 15.30% | 4.20% | 71.76% | NA |
| Indica II | 465 | 3.70% | 19.10% | 7.96% | 69.25% | NA |
| Indica III | 913 | 1.80% | 38.60% | 8.32% | 51.37% | NA |
| Indica Intermediate | 786 | 6.90% | 19.30% | 6.49% | 67.30% | NA |
| Temperate Japonica | 767 | 96.70% | 0.40% | 0.26% | 2.61% | NA |
| Tropical Japonica | 504 | 93.80% | 0.40% | 0.60% | 5.16% | NA |
| Japonica Intermediate | 241 | 95.00% | 0.00% | 0.41% | 4.56% | NA |
| VI/Aromatic | 96 | 18.80% | 0.00% | 1.04% | 80.21% | NA |
| Intermediate | 90 | 38.90% | 7.80% | 2.22% | 51.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1109530326 | T -> DEL | LOC_Os11g17160.1 | N | frameshift_variant | Average:18.343; most accessible tissue: Minghui63 root, score: 33.152 | N | N | N | N |
| vg1109530326 | T -> C | LOC_Os11g17160.1 | missense_variant ; p.Thr21Ala; MODERATE | nonsynonymous_codon ; T21A | Average:18.343; most accessible tissue: Minghui63 root, score: 33.152 | benign |
-0.383 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1109530326 | 1.95E-06 | 1.95E-06 | mr1025_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530326 | NA | 6.83E-07 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530326 | NA | 9.25E-06 | mr1243_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530326 | 1.56E-06 | 1.58E-06 | mr1306_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530326 | NA | 1.74E-07 | mr1376_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530326 | 9.55E-06 | 2.48E-06 | mr1409_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530326 | NA | 1.02E-07 | mr1431_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530326 | 3.60E-06 | 3.60E-06 | mr1463_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530326 | 4.25E-06 | 2.33E-06 | mr1505_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530326 | NA | 1.19E-12 | mr1521_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530326 | NA | 7.17E-06 | mr1554_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530326 | 1.36E-06 | NA | mr1558_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530326 | NA | 8.48E-10 | mr1646_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530326 | NA | 6.16E-06 | mr1649_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530326 | 6.38E-06 | 5.45E-06 | mr1787_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |