\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109530315:

Variant ID: vg1109530315 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 9530315
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, C: 0.02, others allele: 0.00, population size: 57. )

Flanking Sequence (100 bp) in Reference Genome:


GAGGAAGAAAACCGCAAGAAATATAATCTTCGACCGTAACCATACGGCCTAAGATGGGTTCGGGTTCAATACCTCCTATCTCCCTCTGCATGGTCCCGCG[G/A]
CCAGGGAGGGTGCCGTCGTCCTGCAACTTCTTCAGGGATGCGGTGGTGGAGGTGGACTTGTCGATATCCATCGCCGCCGGAGGATCGCCGGAGAGTAAAG

Reverse complement sequence

CTTTACTCTCCGGCGATCCTCCGGCGGCGATGGATATCGACAAGTCCACCTCCACCACCGCATCCCTGAAGAAGTTGCAGGACGACGGCACCCTCCCTGG[C/T]
CGCGGGACCATGCAGAGGGAGATAGGAGGTATTGAACCCGAACCCATCTTAGGCCGTATGGTTACGGTCGAAGATTATATTTCTTGCGGTTTTCTTCCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.20% 13.70% 4.76% 46.34% NA
All Indica  2759 5.40% 23.10% 7.07% 64.48% NA
All Japonica  1512 95.80% 0.10% 0.33% 3.77% NA
Aus  269 4.80% 1.50% 7.81% 85.87% NA
Indica I  595 8.90% 15.60% 3.19% 72.27% NA
Indica II  465 4.10% 17.00% 5.81% 73.12% NA
Indica III  913 2.20% 34.70% 11.50% 51.59% NA
Indica Intermediate  786 7.30% 18.70% 5.60% 68.45% NA
Temperate Japonica  767 97.10% 0.30% 0.00% 2.61% NA
Tropical Japonica  504 94.00% 0.00% 0.60% 5.36% NA
Japonica Intermediate  241 95.00% 0.00% 0.83% 4.15% NA
VI/Aromatic  96 18.80% 0.00% 1.04% 80.21% NA
Intermediate  90 41.10% 4.40% 3.33% 51.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1109530315 G -> A LOC_Os11g17160.1 synonymous_variant ; p.Gly24Gly; LOW synonymous_codon Average:19.768; most accessible tissue: Callus, score: 33.411 N N N N
vg1109530315 G -> A LOC_Os11g17160.1 synonymous_variant ; p.Gly24Gly; LOW nonsynonymous_codon ; G24D Average:19.768; most accessible tissue: Callus, score: 33.411 possibly damaging 1.926 DELETERIOUS 0.01
vg1109530315 G -> DEL LOC_Os11g17160.1 N frameshift_variant Average:19.768; most accessible tissue: Callus, score: 33.411 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1109530315 NA 5.89E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109530315 NA 1.52E-06 mr1243_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109530315 NA 7.95E-06 mr1377_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109530315 7.44E-07 NA mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109530315 NA 8.53E-06 mr1559_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109530315 1.42E-06 5.43E-07 mr1745_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109530315 NA 6.71E-12 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109530315 4.91E-06 4.91E-06 mr1781_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109530315 NA 7.72E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109530315 NA 4.17E-08 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251