\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109530111:

Variant ID: vg1109530111 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 9530111
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


GAAATCCAACACATCCGGACACCCTATTGGGTTCCATCTAGCGCAACTCATAGTAAAATCGGAAAAGATCAAGGAAGGGTTCTACCCCAATGTAGGCCTC[G/A]
CAAAGATAGGAGAAGATGCTGAGGAATGCGATGGAATTGGTGTTCAGGTGAAGCAAAGAAAGGCCATAGAAGTTCAAGACAAGAAGAAGAAATTCGGAAG

Reverse complement sequence

CTTCCGAATTTCTTCTTCTTGTCTTGAACTTCTATGGCCTTTCTTTGCTTCACCTGAACACCAATTCCATCGCATTCCTCAGCATCTTCTCCTATCTTTG[C/T]
GAGGCCTACATTGGGGTAGAACCCTTCCTTGATCTTTTCCGATTTTACTATGAGTTGCGCTAGATGGAACCCAATAGGGTGTCCGGATGTGTTGGATTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.50% 0.20% 1.02% 63.27% NA
All Indica  2759 5.80% 0.10% 1.52% 92.53% NA
All Japonica  1512 95.90% 0.10% 0.26% 3.70% NA
Aus  269 4.80% 0.00% 0.37% 94.80% NA
Indica I  595 10.30% 0.00% 1.85% 87.90% NA
Indica II  465 5.60% 0.00% 0.65% 93.76% NA
Indica III  913 2.00% 0.00% 1.64% 96.39% NA
Indica Intermediate  786 7.00% 0.50% 1.65% 90.84% NA
Temperate Japonica  767 97.30% 0.00% 0.13% 2.61% NA
Tropical Japonica  504 94.20% 0.40% 0.60% 4.76% NA
Japonica Intermediate  241 95.00% 0.00% 0.00% 4.98% NA
VI/Aromatic  96 19.80% 0.00% 1.04% 79.17% NA
Intermediate  90 40.00% 4.40% 0.00% 55.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1109530111 G -> A LOC_Os11g17150.1 downstream_gene_variant ; 4537.0bp to feature; MODIFIER silent_mutation Average:16.799; most accessible tissue: Minghui63 young leaf, score: 23.613 N N N N
vg1109530111 G -> A LOC_Os11g17160.1 intron_variant ; MODIFIER silent_mutation Average:16.799; most accessible tissue: Minghui63 young leaf, score: 23.613 N N N N
vg1109530111 G -> DEL N N silent_mutation Average:16.799; most accessible tissue: Minghui63 young leaf, score: 23.613 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1109530111 NA 3.05E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109530111 NA 7.30E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109530111 NA 2.50E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109530111 NA 7.43E-06 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109530111 NA 1.17E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109530111 2.87E-06 2.87E-06 mr1405_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109530111 NA 9.47E-06 mr1554_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109530111 NA 1.81E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109530111 7.93E-06 4.01E-06 mr1646_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109530111 NA 7.36E-06 mr1691_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109530111 NA 1.24E-08 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109530111 4.36E-06 2.28E-06 mr1751_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109530111 NA 8.00E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109530111 NA 5.14E-06 mr1849_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109530111 8.09E-06 8.09E-06 mr1947_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251