\
| Variant ID: vg1109530111 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 9530111 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 80. )
GAAATCCAACACATCCGGACACCCTATTGGGTTCCATCTAGCGCAACTCATAGTAAAATCGGAAAAGATCAAGGAAGGGTTCTACCCCAATGTAGGCCTC[G/A]
CAAAGATAGGAGAAGATGCTGAGGAATGCGATGGAATTGGTGTTCAGGTGAAGCAAAGAAAGGCCATAGAAGTTCAAGACAAGAAGAAGAAATTCGGAAG
CTTCCGAATTTCTTCTTCTTGTCTTGAACTTCTATGGCCTTTCTTTGCTTCACCTGAACACCAATTCCATCGCATTCCTCAGCATCTTCTCCTATCTTTG[C/T]
GAGGCCTACATTGGGGTAGAACCCTTCCTTGATCTTTTCCGATTTTACTATGAGTTGCGCTAGATGGAACCCAATAGGGTGTCCGGATGTGTTGGATTTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.50% | 0.20% | 1.02% | 63.27% | NA |
| All Indica | 2759 | 5.80% | 0.10% | 1.52% | 92.53% | NA |
| All Japonica | 1512 | 95.90% | 0.10% | 0.26% | 3.70% | NA |
| Aus | 269 | 4.80% | 0.00% | 0.37% | 94.80% | NA |
| Indica I | 595 | 10.30% | 0.00% | 1.85% | 87.90% | NA |
| Indica II | 465 | 5.60% | 0.00% | 0.65% | 93.76% | NA |
| Indica III | 913 | 2.00% | 0.00% | 1.64% | 96.39% | NA |
| Indica Intermediate | 786 | 7.00% | 0.50% | 1.65% | 90.84% | NA |
| Temperate Japonica | 767 | 97.30% | 0.00% | 0.13% | 2.61% | NA |
| Tropical Japonica | 504 | 94.20% | 0.40% | 0.60% | 4.76% | NA |
| Japonica Intermediate | 241 | 95.00% | 0.00% | 0.00% | 4.98% | NA |
| VI/Aromatic | 96 | 19.80% | 0.00% | 1.04% | 79.17% | NA |
| Intermediate | 90 | 40.00% | 4.40% | 0.00% | 55.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1109530111 | G -> A | LOC_Os11g17150.1 | downstream_gene_variant ; 4537.0bp to feature; MODIFIER | silent_mutation | Average:16.799; most accessible tissue: Minghui63 young leaf, score: 23.613 | N | N | N | N |
| vg1109530111 | G -> A | LOC_Os11g17160.1 | intron_variant ; MODIFIER | silent_mutation | Average:16.799; most accessible tissue: Minghui63 young leaf, score: 23.613 | N | N | N | N |
| vg1109530111 | G -> DEL | N | N | silent_mutation | Average:16.799; most accessible tissue: Minghui63 young leaf, score: 23.613 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1109530111 | NA | 3.05E-07 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530111 | NA | 7.30E-11 | mr1751 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530111 | NA | 2.50E-09 | mr1986 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530111 | NA | 7.43E-06 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530111 | NA | 1.17E-06 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530111 | 2.87E-06 | 2.87E-06 | mr1405_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530111 | NA | 9.47E-06 | mr1554_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530111 | NA | 1.81E-10 | mr1646_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530111 | 7.93E-06 | 4.01E-06 | mr1646_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530111 | NA | 7.36E-06 | mr1691_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530111 | NA | 1.24E-08 | mr1751_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530111 | 4.36E-06 | 2.28E-06 | mr1751_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530111 | NA | 8.00E-09 | mr1835_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530111 | NA | 5.14E-06 | mr1849_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109530111 | 8.09E-06 | 8.09E-06 | mr1947_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |