\
| Variant ID: vg1109529411 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 9529411 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 76. )
CTCCTTAGTGACGCCCTCCTTCAATAACGCCGCCGCCTGGTGGTCCACGAGTGGCCCAATGACATCCGTTAGAGGGAGAGCTTCCGTAACATGAAGTCAC[A/G]
ACGCGATCCCGGGGAGAAAGATCTAAAGGAGTCATCGAATACACTCACGTTGATCACAGCCTCGCGTTCAGCCGGACCCTTCTCACAAAGGGGGACGGGG
CCCCGTCCCCCTTTGTGAGAAGGGTCCGGCTGAACGCGAGGCTGTGATCAACGTGAGTGTATTCGATGACTCCTTTAGATCTTTCTCCCCGGGATCGCGT[T/C]
GTGACTTCATGTTACGGAAGCTCTCCCTCTAACGGATGTCATTGGGCCACTCGTGGACCACCAGGCGGCGGCGTTATTGAAGGAGGGCGTCACTAAGGAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.50% | 1.30% | 24.88% | 38.30% | NA |
| All Indica | 2759 | 5.70% | 1.90% | 40.05% | 52.41% | NA |
| All Japonica | 1512 | 95.90% | 0.00% | 0.40% | 3.70% | NA |
| Aus | 269 | 4.80% | 3.00% | 18.59% | 73.61% | NA |
| Indica I | 595 | 9.40% | 1.00% | 20.67% | 68.91% | NA |
| Indica II | 465 | 4.50% | 2.20% | 46.88% | 46.45% | NA |
| Indica III | 913 | 2.10% | 2.00% | 51.92% | 44.03% | NA |
| Indica Intermediate | 786 | 7.60% | 2.30% | 36.90% | 53.18% | NA |
| Temperate Japonica | 767 | 97.10% | 0.00% | 0.00% | 2.87% | NA |
| Tropical Japonica | 504 | 94.40% | 0.00% | 0.79% | 4.76% | NA |
| Japonica Intermediate | 241 | 95.00% | 0.00% | 0.83% | 4.15% | NA |
| VI/Aromatic | 96 | 19.80% | 1.00% | 1.04% | 78.12% | NA |
| Intermediate | 90 | 43.30% | 2.20% | 15.56% | 38.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1109529411 | A -> DEL | N | N | silent_mutation | Average:24.404; most accessible tissue: Callus, score: 43.963 | N | N | N | N |
| vg1109529411 | A -> G | LOC_Os11g17150.1 | downstream_gene_variant ; 3837.0bp to feature; MODIFIER | silent_mutation | Average:24.404; most accessible tissue: Callus, score: 43.963 | N | N | N | N |
| vg1109529411 | A -> G | LOC_Os11g17160.1 | intron_variant ; MODIFIER | silent_mutation | Average:24.404; most accessible tissue: Callus, score: 43.963 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1109529411 | NA | 1.19E-18 | Yield | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1109529411 | NA | 8.52E-07 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109529411 | NA | 9.85E-11 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109529411 | NA | 9.61E-13 | mr1326 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109529411 | NA | 1.92E-09 | mr1336 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109529411 | NA | 2.77E-06 | mr1527 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109529411 | NA | 2.06E-11 | mr1751 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109529411 | NA | 1.60E-08 | mr1986 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109529411 | 1.68E-06 | 1.68E-06 | mr1405_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109529411 | 2.81E-06 | 4.04E-06 | mr1741_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109529411 | NA | 5.66E-09 | mr1835_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |