\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109529411:

Variant ID: vg1109529411 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 9529411
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


CTCCTTAGTGACGCCCTCCTTCAATAACGCCGCCGCCTGGTGGTCCACGAGTGGCCCAATGACATCCGTTAGAGGGAGAGCTTCCGTAACATGAAGTCAC[A/G]
ACGCGATCCCGGGGAGAAAGATCTAAAGGAGTCATCGAATACACTCACGTTGATCACAGCCTCGCGTTCAGCCGGACCCTTCTCACAAAGGGGGACGGGG

Reverse complement sequence

CCCCGTCCCCCTTTGTGAGAAGGGTCCGGCTGAACGCGAGGCTGTGATCAACGTGAGTGTATTCGATGACTCCTTTAGATCTTTCTCCCCGGGATCGCGT[T/C]
GTGACTTCATGTTACGGAAGCTCTCCCTCTAACGGATGTCATTGGGCCACTCGTGGACCACCAGGCGGCGGCGTTATTGAAGGAGGGCGTCACTAAGGAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.50% 1.30% 24.88% 38.30% NA
All Indica  2759 5.70% 1.90% 40.05% 52.41% NA
All Japonica  1512 95.90% 0.00% 0.40% 3.70% NA
Aus  269 4.80% 3.00% 18.59% 73.61% NA
Indica I  595 9.40% 1.00% 20.67% 68.91% NA
Indica II  465 4.50% 2.20% 46.88% 46.45% NA
Indica III  913 2.10% 2.00% 51.92% 44.03% NA
Indica Intermediate  786 7.60% 2.30% 36.90% 53.18% NA
Temperate Japonica  767 97.10% 0.00% 0.00% 2.87% NA
Tropical Japonica  504 94.40% 0.00% 0.79% 4.76% NA
Japonica Intermediate  241 95.00% 0.00% 0.83% 4.15% NA
VI/Aromatic  96 19.80% 1.00% 1.04% 78.12% NA
Intermediate  90 43.30% 2.20% 15.56% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1109529411 A -> DEL N N silent_mutation Average:24.404; most accessible tissue: Callus, score: 43.963 N N N N
vg1109529411 A -> G LOC_Os11g17150.1 downstream_gene_variant ; 3837.0bp to feature; MODIFIER silent_mutation Average:24.404; most accessible tissue: Callus, score: 43.963 N N N N
vg1109529411 A -> G LOC_Os11g17160.1 intron_variant ; MODIFIER silent_mutation Average:24.404; most accessible tissue: Callus, score: 43.963 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1109529411 NA 1.19E-18 Yield All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1109529411 NA 8.52E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109529411 NA 9.85E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109529411 NA 9.61E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109529411 NA 1.92E-09 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109529411 NA 2.77E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109529411 NA 2.06E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109529411 NA 1.60E-08 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109529411 1.68E-06 1.68E-06 mr1405_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109529411 2.81E-06 4.04E-06 mr1741_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109529411 NA 5.66E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251