Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109493134:

Variant ID: vg1109493134 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 9493134
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, T: 0.05, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

CAATTAAGGACCCATTTGAATCAAAGAATTTATATAGAAATTTCATAGAATTTAAATCTTATAGGAAATTTTTCTATTTGCCCCTTTGATTTAAAGGATC[G/A]
AAGTTTTTCAAATCCTATAAAATTTCTATGGAATGGCACATTGCATGTGGATTTTGGAGGAAATTTAGCAACAGCTCCAACCTCTTGGAAAATTTTCTTT

Reverse complement sequence

AAAGAAAATTTTCCAAGAGGTTGGAGCTGTTGCTAAATTTCCTCCAAAATCCACATGCAATGTGCCATTCCATAGAAATTTTATAGGATTTGAAAAACTT[C/T]
GATCCTTTAAATCAAAGGGGCAAATAGAAAAATTTCCTATAAGATTTAAATTCTATGAAATTTCTATATAAATTCTTTGATTCAAATGGGTCCTTAATTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.90%	26.00%	0.53%	2.54%	NA
All Indica	2759	54.70%	43.10%	0.87%	1.34%	NA
All Japonica	1512	97.90%	1.00%	0.00%	1.12%	NA
Aus	269	97.80%	1.90%	0.00%	0.37%	NA
Indica I	595	41.30%	54.80%	0.84%	3.03%	NA
Indica II	465	66.70%	31.20%	1.51%	0.65%	NA
Indica III	913	49.30%	48.80%	0.99%	0.88%	NA
Indica Intermediate	786	64.10%	34.50%	0.38%	1.02%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	95.80%	2.60%	0.00%	1.59%	NA
Japonica Intermediate	241	95.90%	0.80%	0.00%	3.32%	NA
VI/Aromatic	96	33.30%	4.20%	0.00%	62.50%	NA
Intermediate	90	75.60%	17.80%	1.11%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1109493134	G -> A	LOC_Os11g17100.1	downstream_gene_variant ; 2321.0bp to feature; MODIFIER	silent_mutation	Average:52.798; most accessible tissue: Zhenshan97 flower, score: 72.578	N	N	N	N
vg1109493134	G -> A	LOC_Os11g17090-LOC_Os11g17100	intergenic_region ; MODIFIER	silent_mutation	Average:52.798; most accessible tissue: Zhenshan97 flower, score: 72.578	N	N	N	N
vg1109493134	G -> DEL	N	N	silent_mutation	Average:52.798; most accessible tissue: Zhenshan97 flower, score: 72.578	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1109493134	NA	8.02E-07	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109493134	NA	7.88E-08	mr1092_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109493134	NA	1.42E-06	mr1097_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109493134	NA	2.15E-09	mr1152_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109493134	NA	7.47E-10	mr1154_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109493134	NA	2.05E-06	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251