\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109467388:

Variant ID: vg1109467388 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 9467388
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


AAAACTATCAGAATTTTGTCTTTTTGTTATGTCTAGAATATCTAATGAATATGAATATGAGATTTTATAGATATGTGAAATACTATTAGGAGTAAATGTA[C/T]
AATTTTTTTGTAGAACTTTTTCGTGACATTTACTAGTTGGTGTACATAGAGTGTGCACAGAAAGCTTGTGTGCATAGGATATGTTCCCTCTACGATTTTT

Reverse complement sequence

AAAAATCGTAGAGGGAACATATCCTATGCACACAAGCTTTCTGTGCACACTCTATGTACACCAACTAGTAAATGTCACGAAAAAGTTCTACAAAAAAATT[G/A]
TACATTTACTCCTAATAGTATTTCACATATCTATAAAATCTCATATTCATATTCATTAGATATTCTAGACATAACAAAAAGACAAAATTCTGATAGTTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.80% 19.10% 4.93% 43.12% NA
All Indica  2759 3.80% 22.20% 5.47% 68.47% NA
All Japonica  1512 92.00% 0.20% 1.39% 6.42% NA
Aus  269 3.70% 92.90% 0.37% 2.97% NA
Indica I  595 4.90% 0.30% 4.20% 90.59% NA
Indica II  465 2.20% 52.00% 1.72% 44.09% NA
Indica III  913 3.60% 21.40% 6.68% 68.35% NA
Indica Intermediate  786 4.30% 22.10% 7.25% 66.28% NA
Temperate Japonica  767 96.60% 0.10% 0.39% 2.87% NA
Tropical Japonica  504 84.90% 0.20% 1.98% 12.90% NA
Japonica Intermediate  241 92.10% 0.40% 3.32% 4.15% NA
VI/Aromatic  96 19.80% 11.50% 56.25% 12.50% NA
Intermediate  90 28.90% 28.90% 6.67% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1109467388 C -> T LOC_Os11g17070.1 upstream_gene_variant ; 992.0bp to feature; MODIFIER silent_mutation Average:37.672; most accessible tissue: Zhenshan97 young leaf, score: 54.618 N N N N
vg1109467388 C -> T LOC_Os11g17080.1 upstream_gene_variant ; 4133.0bp to feature; MODIFIER silent_mutation Average:37.672; most accessible tissue: Zhenshan97 young leaf, score: 54.618 N N N N
vg1109467388 C -> T LOC_Os11g17080.3 upstream_gene_variant ; 4165.0bp to feature; MODIFIER silent_mutation Average:37.672; most accessible tissue: Zhenshan97 young leaf, score: 54.618 N N N N
vg1109467388 C -> T LOC_Os11g17080.2 upstream_gene_variant ; 4265.0bp to feature; MODIFIER silent_mutation Average:37.672; most accessible tissue: Zhenshan97 young leaf, score: 54.618 N N N N
vg1109467388 C -> T LOC_Os11g17070-LOC_Os11g17080 intergenic_region ; MODIFIER silent_mutation Average:37.672; most accessible tissue: Zhenshan97 young leaf, score: 54.618 N N N N
vg1109467388 C -> DEL N N silent_mutation Average:37.672; most accessible tissue: Zhenshan97 young leaf, score: 54.618 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1109467388 NA 1.28E-07 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109467388 NA 2.33E-09 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109467388 NA 1.92E-08 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109467388 NA 1.66E-06 mr1415 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109467388 NA 1.66E-06 mr1567 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109467388 NA 3.33E-07 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109467388 NA 4.61E-13 mr1806 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109467388 NA 1.29E-11 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109467388 NA 7.76E-07 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109467388 NA 3.78E-10 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109467388 NA 3.61E-11 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109467388 NA 3.68E-09 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109467388 NA 1.93E-09 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109467388 NA 7.89E-08 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109467388 NA 2.67E-09 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109467388 NA 1.74E-12 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109467388 NA 6.82E-08 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109467388 NA 4.59E-11 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251