Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109467388:

Variant ID: vg1109467388 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 9467388
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

AAAACTATCAGAATTTTGTCTTTTTGTTATGTCTAGAATATCTAATGAATATGAATATGAGATTTTATAGATATGTGAAATACTATTAGGAGTAAATGTA[C/T]
AATTTTTTTGTAGAACTTTTTCGTGACATTTACTAGTTGGTGTACATAGAGTGTGCACAGAAAGCTTGTGTGCATAGGATATGTTCCCTCTACGATTTTT

Reverse complement sequence

AAAAATCGTAGAGGGAACATATCCTATGCACACAAGCTTTCTGTGCACACTCTATGTACACCAACTAGTAAATGTCACGAAAAAGTTCTACAAAAAAATT[G/A]
TACATTTACTCCTAATAGTATTTCACATATCTATAAAATCTCATATTCATATTCATTAGATATTCTAGACATAACAAAAAGACAAAATTCTGATAGTTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.80%	19.10%	4.93%	43.12%	NA
All Indica	2759	3.80%	22.20%	5.47%	68.47%	NA
All Japonica	1512	92.00%	0.20%	1.39%	6.42%	NA
Aus	269	3.70%	92.90%	0.37%	2.97%	NA
Indica I	595	4.90%	0.30%	4.20%	90.59%	NA
Indica II	465	2.20%	52.00%	1.72%	44.09%	NA
Indica III	913	3.60%	21.40%	6.68%	68.35%	NA
Indica Intermediate	786	4.30%	22.10%	7.25%	66.28%	NA
Temperate Japonica	767	96.60%	0.10%	0.39%	2.87%	NA
Tropical Japonica	504	84.90%	0.20%	1.98%	12.90%	NA
Japonica Intermediate	241	92.10%	0.40%	3.32%	4.15%	NA
VI/Aromatic	96	19.80%	11.50%	56.25%	12.50%	NA
Intermediate	90	28.90%	28.90%	6.67%	35.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1109467388	C -> T	LOC_Os11g17070.1	upstream_gene_variant ; 992.0bp to feature; MODIFIER	silent_mutation	Average:37.672; most accessible tissue: Zhenshan97 young leaf, score: 54.618	N	N	N	N
vg1109467388	C -> T	LOC_Os11g17080.1	upstream_gene_variant ; 4133.0bp to feature; MODIFIER	silent_mutation	Average:37.672; most accessible tissue: Zhenshan97 young leaf, score: 54.618	N	N	N	N
vg1109467388	C -> T	LOC_Os11g17080.3	upstream_gene_variant ; 4165.0bp to feature; MODIFIER	silent_mutation	Average:37.672; most accessible tissue: Zhenshan97 young leaf, score: 54.618	N	N	N	N
vg1109467388	C -> T	LOC_Os11g17080.2	upstream_gene_variant ; 4265.0bp to feature; MODIFIER	silent_mutation	Average:37.672; most accessible tissue: Zhenshan97 young leaf, score: 54.618	N	N	N	N
vg1109467388	C -> T	LOC_Os11g17070-LOC_Os11g17080	intergenic_region ; MODIFIER	silent_mutation	Average:37.672; most accessible tissue: Zhenshan97 young leaf, score: 54.618	N	N	N	N
vg1109467388	C -> DEL	N	N	silent_mutation	Average:37.672; most accessible tissue: Zhenshan97 young leaf, score: 54.618	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1109467388	NA	1.28E-07	mr1059	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109467388	NA	2.33E-09	mr1143	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109467388	NA	1.92E-08	mr1167	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109467388	NA	1.66E-06	mr1415	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109467388	NA	1.66E-06	mr1567	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109467388	NA	3.33E-07	mr1726	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109467388	NA	4.61E-13	mr1806	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109467388	NA	1.29E-11	mr1829	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109467388	NA	7.76E-07	mr1842	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109467388	NA	3.78E-10	mr1902	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109467388	NA	3.61E-11	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109467388	NA	3.68E-09	mr1969	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109467388	NA	1.93E-09	mr1995	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109467388	NA	7.89E-08	mr1158_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109467388	NA	2.67E-09	mr1715_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109467388	NA	1.74E-12	mr1829_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109467388	NA	6.82E-08	mr1842_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109467388	NA	4.59E-11	mr1902_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251