\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109440009:

Variant ID: vg1109440009 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 9440009
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATCGAATAGATTTAGTTCTTTCTCGCTTACTAATGATTGTCGATCGATTCAAATATGACATCGTCTCAAAGATAAAGGATATGTCATCGGCGGCTGGCC[A/G]
ATCGACTATCATTTACCACAGTTTCTTTGTCTTTATTTCTTGTTGATTACAGGATCAAATCAACTGGCACGCTCATGAACCAAAAGGCAAGATTTTTTGA

Reverse complement sequence

TCAAAAAATCTTGCCTTTTGGTTCATGAGCGTGCCAGTTGATTTGATCCTGTAATCAACAAGAAATAAAGACAAAGAAACTGTGGTAAATGATAGTCGAT[T/C]
GGCCAGCCGCCGATGACATATCCTTTATCTTTGAGACGATGTCATATTTGAATCGATCGACAATCATTAGTAAGCGAGAAAGAACTAAATCTATTCGATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.30% 39.20% 0.00% 0.55% NA
All Indica  2759 95.80% 3.60% 0.00% 0.58% NA
All Japonica  1512 3.80% 95.80% 0.00% 0.46% NA
Aus  269 10.40% 89.20% 0.00% 0.37% NA
Indica I  595 93.80% 3.50% 0.00% 2.69% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 96.90% 3.10% 0.00% 0.00% NA
Indica Intermediate  786 94.00% 6.00% 0.00% 0.00% NA
Temperate Japonica  767 3.40% 96.60% 0.00% 0.00% NA
Tropical Japonica  504 3.80% 94.80% 0.00% 1.39% NA
Japonica Intermediate  241 5.00% 95.00% 0.00% 0.00% NA
VI/Aromatic  96 71.90% 28.10% 0.00% 0.00% NA
Intermediate  90 57.80% 40.00% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1109440009 A -> DEL N N silent_mutation Average:33.33; most accessible tissue: Zhenshan97 young leaf, score: 52.657 N N N N
vg1109440009 A -> G LOC_Os11g17040.1 upstream_gene_variant ; 293.0bp to feature; MODIFIER silent_mutation Average:33.33; most accessible tissue: Zhenshan97 young leaf, score: 52.657 N N N N
vg1109440009 A -> G LOC_Os11g17030.1 downstream_gene_variant ; 1466.0bp to feature; MODIFIER silent_mutation Average:33.33; most accessible tissue: Zhenshan97 young leaf, score: 52.657 N N N N
vg1109440009 A -> G LOC_Os11g17030-LOC_Os11g17040 intergenic_region ; MODIFIER silent_mutation Average:33.33; most accessible tissue: Zhenshan97 young leaf, score: 52.657 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1109440009 NA 3.65E-48 mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109440009 NA 8.70E-18 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109440009 NA 6.95E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109440009 NA 4.59E-25 mr1551 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109440009 NA 1.41E-34 mr1793 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109440009 NA 6.20E-24 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109440009 NA 1.01E-17 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109440009 NA 5.51E-15 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109440009 NA 6.33E-22 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109440009 NA 4.27E-40 mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109440009 NA 2.45E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109440009 NA 1.03E-51 mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109440009 NA 9.80E-32 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251