\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109375967:

Variant ID: vg1109375967 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 9375967
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


AACAACAAAAAACATTGGAGGATGAAGTTACTAACCTTTTAGACACCTCCGATTTGTATATAATCACCAAAAAAATTTCACAAGAAATTTTGGCATGACC[T/C]
CCCCTCTTTTTTGGAGAAATTTTGAAGCTTGCTCGGGCTGGAGGAGGAAGAAGACATATATAAAGGGGGGGAGATCACCGGGACTAAAGATCGTATATGC

Reverse complement sequence

GCATATACGATCTTTAGTCCCGGTGATCTCCCCCCCTTTATATATGTCTTCTTCCTCCTCCAGCCCGAGCAAGCTTCAAAATTTCTCCAAAAAAGAGGGG[A/G]
GGTCATGCCAAAATTTCTTGTGAAATTTTTTTGGTGATTATATACAAATCGGAGGTGTCTAAAAGGTTAGTAACTTCATCCTCCAATGTTTTTTGTTGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.00% 10.40% 0.55% 0.00% NA
All Indica  2759 81.80% 17.30% 0.94% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 49.50% 47.30% 3.23% 0.00% NA
Indica III  913 85.40% 14.00% 0.55% 0.00% NA
Indica Intermediate  786 83.00% 16.30% 0.76% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1109375967 T -> C LOC_Os11g16890.1 upstream_gene_variant ; 4784.0bp to feature; MODIFIER silent_mutation Average:36.159; most accessible tissue: Minghui63 flag leaf, score: 49.864 N N N N
vg1109375967 T -> C LOC_Os11g16900.1 upstream_gene_variant ; 507.0bp to feature; MODIFIER silent_mutation Average:36.159; most accessible tissue: Minghui63 flag leaf, score: 49.864 N N N N
vg1109375967 T -> C LOC_Os11g16900-LOC_Os11g16910 intergenic_region ; MODIFIER silent_mutation Average:36.159; most accessible tissue: Minghui63 flag leaf, score: 49.864 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1109375967 2.45E-06 5.93E-07 mr1392 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109375967 NA 1.81E-08 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109375967 NA 1.96E-11 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109375967 NA 2.99E-10 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109375967 NA 7.28E-13 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109375967 NA 3.22E-08 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109375967 NA 1.09E-11 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251