\
| Variant ID: vg1109375967 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 9375967 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 232. )
AACAACAAAAAACATTGGAGGATGAAGTTACTAACCTTTTAGACACCTCCGATTTGTATATAATCACCAAAAAAATTTCACAAGAAATTTTGGCATGACC[T/C]
CCCCTCTTTTTTGGAGAAATTTTGAAGCTTGCTCGGGCTGGAGGAGGAAGAAGACATATATAAAGGGGGGGAGATCACCGGGACTAAAGATCGTATATGC
GCATATACGATCTTTAGTCCCGGTGATCTCCCCCCCTTTATATATGTCTTCTTCCTCCTCCAGCCCGAGCAAGCTTCAAAATTTCTCCAAAAAAGAGGGG[A/G]
GGTCATGCCAAAATTTCTTGTGAAATTTTTTTGGTGATTATATACAAATCGGAGGTGTCTAAAAGGTTAGTAACTTCATCCTCCAATGTTTTTTGTTGTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.00% | 10.40% | 0.55% | 0.00% | NA |
| All Indica | 2759 | 81.80% | 17.30% | 0.94% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 49.50% | 47.30% | 3.23% | 0.00% | NA |
| Indica III | 913 | 85.40% | 14.00% | 0.55% | 0.00% | NA |
| Indica Intermediate | 786 | 83.00% | 16.30% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1109375967 | T -> C | LOC_Os11g16890.1 | upstream_gene_variant ; 4784.0bp to feature; MODIFIER | silent_mutation | Average:36.159; most accessible tissue: Minghui63 flag leaf, score: 49.864 | N | N | N | N |
| vg1109375967 | T -> C | LOC_Os11g16900.1 | upstream_gene_variant ; 507.0bp to feature; MODIFIER | silent_mutation | Average:36.159; most accessible tissue: Minghui63 flag leaf, score: 49.864 | N | N | N | N |
| vg1109375967 | T -> C | LOC_Os11g16900-LOC_Os11g16910 | intergenic_region ; MODIFIER | silent_mutation | Average:36.159; most accessible tissue: Minghui63 flag leaf, score: 49.864 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1109375967 | 2.45E-06 | 5.93E-07 | mr1392 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109375967 | NA | 1.81E-08 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109375967 | NA | 1.96E-11 | mr1829 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109375967 | NA | 2.99E-10 | mr1902 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109375967 | NA | 7.28E-13 | mr1829_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109375967 | NA | 3.22E-08 | mr1842_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109375967 | NA | 1.09E-11 | mr1902_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |