\
| Variant ID: vg1109270791 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 9270791 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 213. )
ACCGGGTAGGTTGTATTTTCTACTGACCCGACAGAGCTTGGGATTTGCATTGACTACGAGCCTTGTGGAACCAGGTTTGGGAAGGGTTGAGGATGTTGTG[C/T]
GGCAAGACTGTAGAACTATTGGGTGATTTGTTTGGTTACTTGGTCTGTGATTTCCTGACGCATCTTCGCCTTATAGGCATCCCGCTTCTTGTAACTTTCA
TGAAAGTTACAAGAAGCGGGATGCCTATAAGGCGAAGATGCGTCAGGAAATCACAGACCAAGTAACCAAACAAATCACCCAATAGTTCTACAGTCTTGCC[G/A]
CACAACATCCTCAACCCTTCCCAAACCTGGTTCCACAAGGCTCGTAGTCAATGCAAATCCCAAGCTCTGTCGGGTCAGTAGAAAATACAACCTACCCGGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.40% | 13.90% | 5.92% | 17.75% | NA |
| All Indica | 2759 | 62.30% | 0.40% | 8.08% | 29.21% | NA |
| All Japonica | 1512 | 54.50% | 40.70% | 3.17% | 1.65% | NA |
| Aus | 269 | 97.40% | 1.10% | 1.49% | 0.00% | NA |
| Indica I | 595 | 24.90% | 0.30% | 17.31% | 57.48% | NA |
| Indica II | 465 | 68.40% | 0.00% | 3.66% | 27.96% | NA |
| Indica III | 913 | 83.00% | 0.40% | 3.61% | 12.92% | NA |
| Indica Intermediate | 786 | 63.10% | 0.50% | 8.91% | 27.48% | NA |
| Temperate Japonica | 767 | 67.30% | 26.50% | 4.17% | 2.09% | NA |
| Tropical Japonica | 504 | 29.40% | 67.70% | 1.79% | 1.19% | NA |
| Japonica Intermediate | 241 | 66.40% | 29.50% | 2.90% | 1.24% | NA |
| VI/Aromatic | 96 | 80.20% | 16.70% | 2.08% | 1.04% | NA |
| Intermediate | 90 | 75.60% | 13.30% | 3.33% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1109270791 | C -> T | LOC_Os11g16740.1 | upstream_gene_variant ; 4295.0bp to feature; MODIFIER | silent_mutation | Average:41.553; most accessible tissue: Minghui63 young leaf, score: 78.443 | N | N | N | N |
| vg1109270791 | C -> T | LOC_Os11g16730.1 | intron_variant ; MODIFIER | silent_mutation | Average:41.553; most accessible tissue: Minghui63 young leaf, score: 78.443 | N | N | N | N |
| vg1109270791 | C -> DEL | N | N | silent_mutation | Average:41.553; most accessible tissue: Minghui63 young leaf, score: 78.443 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1109270791 | NA | 2.29E-06 | mr1026 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109270791 | 4.92E-06 | NA | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109270791 | NA | 5.77E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109270791 | NA | 5.78E-13 | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109270791 | 1.06E-06 | NA | mr1489_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109270791 | 2.93E-08 | NA | mr1778_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |