\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109270791:

Variant ID: vg1109270791 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 9270791
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


ACCGGGTAGGTTGTATTTTCTACTGACCCGACAGAGCTTGGGATTTGCATTGACTACGAGCCTTGTGGAACCAGGTTTGGGAAGGGTTGAGGATGTTGTG[C/T]
GGCAAGACTGTAGAACTATTGGGTGATTTGTTTGGTTACTTGGTCTGTGATTTCCTGACGCATCTTCGCCTTATAGGCATCCCGCTTCTTGTAACTTTCA

Reverse complement sequence

TGAAAGTTACAAGAAGCGGGATGCCTATAAGGCGAAGATGCGTCAGGAAATCACAGACCAAGTAACCAAACAAATCACCCAATAGTTCTACAGTCTTGCC[G/A]
CACAACATCCTCAACCCTTCCCAAACCTGGTTCCACAAGGCTCGTAGTCAATGCAAATCCCAAGCTCTGTCGGGTCAGTAGAAAATACAACCTACCCGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.40% 13.90% 5.92% 17.75% NA
All Indica  2759 62.30% 0.40% 8.08% 29.21% NA
All Japonica  1512 54.50% 40.70% 3.17% 1.65% NA
Aus  269 97.40% 1.10% 1.49% 0.00% NA
Indica I  595 24.90% 0.30% 17.31% 57.48% NA
Indica II  465 68.40% 0.00% 3.66% 27.96% NA
Indica III  913 83.00% 0.40% 3.61% 12.92% NA
Indica Intermediate  786 63.10% 0.50% 8.91% 27.48% NA
Temperate Japonica  767 67.30% 26.50% 4.17% 2.09% NA
Tropical Japonica  504 29.40% 67.70% 1.79% 1.19% NA
Japonica Intermediate  241 66.40% 29.50% 2.90% 1.24% NA
VI/Aromatic  96 80.20% 16.70% 2.08% 1.04% NA
Intermediate  90 75.60% 13.30% 3.33% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1109270791 C -> T LOC_Os11g16740.1 upstream_gene_variant ; 4295.0bp to feature; MODIFIER silent_mutation Average:41.553; most accessible tissue: Minghui63 young leaf, score: 78.443 N N N N
vg1109270791 C -> T LOC_Os11g16730.1 intron_variant ; MODIFIER silent_mutation Average:41.553; most accessible tissue: Minghui63 young leaf, score: 78.443 N N N N
vg1109270791 C -> DEL N N silent_mutation Average:41.553; most accessible tissue: Minghui63 young leaf, score: 78.443 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1109270791 NA 2.29E-06 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109270791 4.92E-06 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109270791 NA 5.77E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109270791 NA 5.78E-13 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109270791 1.06E-06 NA mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109270791 2.93E-08 NA mr1778_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251