Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109263217:

Variant ID: vg1109263217 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 9263217
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.22, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

TATGGTTCATTGCGGGGCACCAGACTAAGAAGTGACGGAGATAAGCCCACGGGGGTCACTGGGGAGTCCATGCCTTGTTTATAAGGGGGTGATTATGATC[C/T]
AGGAACGGTGCGCTGTGGTGGATTGTGTTATGCGAGGGGTCTATCACAGCTCCTTTCCGAGGTACCGTGGTGGTATTGAGGCGCATGGTGACATGTCGTG

Reverse complement sequence

CACGACATGTCACCATGCGCCTCAATACCACCACGGTACCTCGGAAAGGAGCTGTGATAGACCCCTCGCATAACACAATCCACCACAGCGCACCGTTCCT[G/A]
GATCATAATCACCCCCTTATAAACAAGGCATGGACTCCCCAGTGACCCCCGTGGGCTTATCTCCGTCACTTCTTAGTCTGGTGCCCCGCAATGAACCATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.00%	20.90%	7.87%	20.19%	NA
All Indica	2759	23.20%	30.40%	13.19%	33.20%	NA
All Japonica	1512	95.80%	2.10%	0.20%	1.92%	NA
Aus	269	91.10%	8.60%	0.00%	0.37%	NA
Indica I	595	26.70%	8.20%	20.17%	44.87%	NA
Indica II	465	7.30%	59.60%	6.45%	26.67%	NA
Indica III	913	25.70%	31.40%	13.80%	29.03%	NA
Indica Intermediate	786	27.00%	28.80%	11.20%	33.08%	NA
Temperate Japonica	767	97.30%	0.40%	0.13%	2.22%	NA
Tropical Japonica	504	94.00%	3.80%	0.40%	1.79%	NA
Japonica Intermediate	241	94.60%	4.10%	0.00%	1.24%	NA
VI/Aromatic	96	32.30%	67.70%	0.00%	0.00%	NA
Intermediate	90	52.20%	33.30%	5.56%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1109263217	C -> T	LOC_Os11g16710.1	upstream_gene_variant ; 1823.0bp to feature; MODIFIER	silent_mutation	Average:31.667; most accessible tissue: Minghui63 young leaf, score: 70.655	N	N	N	N
vg1109263217	C -> T	LOC_Os11g16720.1	upstream_gene_variant ; 1120.0bp to feature; MODIFIER	silent_mutation	Average:31.667; most accessible tissue: Minghui63 young leaf, score: 70.655	N	N	N	N
vg1109263217	C -> T	LOC_Os11g16730.1	downstream_gene_variant ; 3426.0bp to feature; MODIFIER	silent_mutation	Average:31.667; most accessible tissue: Minghui63 young leaf, score: 70.655	N	N	N	N
vg1109263217	C -> T	LOC_Os11g16710-LOC_Os11g16720	intergenic_region ; MODIFIER	silent_mutation	Average:31.667; most accessible tissue: Minghui63 young leaf, score: 70.655	N	N	N	N
vg1109263217	C -> DEL	N	N	silent_mutation	Average:31.667; most accessible tissue: Minghui63 young leaf, score: 70.655	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1109263217	NA	6.46E-08	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109263217	NA	2.37E-06	mr1135	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109263217	NA	4.61E-07	mr1149	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109263217	2.34E-07	2.34E-07	mr1159	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109263217	NA	2.27E-06	mr1504	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109263217	5.23E-07	2.02E-09	mr1837	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251