\
| Variant ID: vg1109263217 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 9263217 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.22, others allele: 0.00, population size: 89. )
TATGGTTCATTGCGGGGCACCAGACTAAGAAGTGACGGAGATAAGCCCACGGGGGTCACTGGGGAGTCCATGCCTTGTTTATAAGGGGGTGATTATGATC[C/T]
AGGAACGGTGCGCTGTGGTGGATTGTGTTATGCGAGGGGTCTATCACAGCTCCTTTCCGAGGTACCGTGGTGGTATTGAGGCGCATGGTGACATGTCGTG
CACGACATGTCACCATGCGCCTCAATACCACCACGGTACCTCGGAAAGGAGCTGTGATAGACCCCTCGCATAACACAATCCACCACAGCGCACCGTTCCT[G/A]
GATCATAATCACCCCCTTATAAACAAGGCATGGACTCCCCAGTGACCCCCGTGGGCTTATCTCCGTCACTTCTTAGTCTGGTGCCCCGCAATGAACCATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.00% | 20.90% | 7.87% | 20.19% | NA |
| All Indica | 2759 | 23.20% | 30.40% | 13.19% | 33.20% | NA |
| All Japonica | 1512 | 95.80% | 2.10% | 0.20% | 1.92% | NA |
| Aus | 269 | 91.10% | 8.60% | 0.00% | 0.37% | NA |
| Indica I | 595 | 26.70% | 8.20% | 20.17% | 44.87% | NA |
| Indica II | 465 | 7.30% | 59.60% | 6.45% | 26.67% | NA |
| Indica III | 913 | 25.70% | 31.40% | 13.80% | 29.03% | NA |
| Indica Intermediate | 786 | 27.00% | 28.80% | 11.20% | 33.08% | NA |
| Temperate Japonica | 767 | 97.30% | 0.40% | 0.13% | 2.22% | NA |
| Tropical Japonica | 504 | 94.00% | 3.80% | 0.40% | 1.79% | NA |
| Japonica Intermediate | 241 | 94.60% | 4.10% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 32.30% | 67.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 33.30% | 5.56% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1109263217 | C -> T | LOC_Os11g16710.1 | upstream_gene_variant ; 1823.0bp to feature; MODIFIER | silent_mutation | Average:31.667; most accessible tissue: Minghui63 young leaf, score: 70.655 | N | N | N | N |
| vg1109263217 | C -> T | LOC_Os11g16720.1 | upstream_gene_variant ; 1120.0bp to feature; MODIFIER | silent_mutation | Average:31.667; most accessible tissue: Minghui63 young leaf, score: 70.655 | N | N | N | N |
| vg1109263217 | C -> T | LOC_Os11g16730.1 | downstream_gene_variant ; 3426.0bp to feature; MODIFIER | silent_mutation | Average:31.667; most accessible tissue: Minghui63 young leaf, score: 70.655 | N | N | N | N |
| vg1109263217 | C -> T | LOC_Os11g16710-LOC_Os11g16720 | intergenic_region ; MODIFIER | silent_mutation | Average:31.667; most accessible tissue: Minghui63 young leaf, score: 70.655 | N | N | N | N |
| vg1109263217 | C -> DEL | N | N | silent_mutation | Average:31.667; most accessible tissue: Minghui63 young leaf, score: 70.655 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1109263217 | NA | 6.46E-08 | mr1077 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109263217 | NA | 2.37E-06 | mr1135 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109263217 | NA | 4.61E-07 | mr1149 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109263217 | 2.34E-07 | 2.34E-07 | mr1159 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109263217 | NA | 2.27E-06 | mr1504 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109263217 | 5.23E-07 | 2.02E-09 | mr1837 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |