\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109263217:

Variant ID: vg1109263217 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 9263217
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.22, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


TATGGTTCATTGCGGGGCACCAGACTAAGAAGTGACGGAGATAAGCCCACGGGGGTCACTGGGGAGTCCATGCCTTGTTTATAAGGGGGTGATTATGATC[C/T]
AGGAACGGTGCGCTGTGGTGGATTGTGTTATGCGAGGGGTCTATCACAGCTCCTTTCCGAGGTACCGTGGTGGTATTGAGGCGCATGGTGACATGTCGTG

Reverse complement sequence

CACGACATGTCACCATGCGCCTCAATACCACCACGGTACCTCGGAAAGGAGCTGTGATAGACCCCTCGCATAACACAATCCACCACAGCGCACCGTTCCT[G/A]
GATCATAATCACCCCCTTATAAACAAGGCATGGACTCCCCAGTGACCCCCGTGGGCTTATCTCCGTCACTTCTTAGTCTGGTGCCCCGCAATGAACCATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.00% 20.90% 7.87% 20.19% NA
All Indica  2759 23.20% 30.40% 13.19% 33.20% NA
All Japonica  1512 95.80% 2.10% 0.20% 1.92% NA
Aus  269 91.10% 8.60% 0.00% 0.37% NA
Indica I  595 26.70% 8.20% 20.17% 44.87% NA
Indica II  465 7.30% 59.60% 6.45% 26.67% NA
Indica III  913 25.70% 31.40% 13.80% 29.03% NA
Indica Intermediate  786 27.00% 28.80% 11.20% 33.08% NA
Temperate Japonica  767 97.30% 0.40% 0.13% 2.22% NA
Tropical Japonica  504 94.00% 3.80% 0.40% 1.79% NA
Japonica Intermediate  241 94.60% 4.10% 0.00% 1.24% NA
VI/Aromatic  96 32.30% 67.70% 0.00% 0.00% NA
Intermediate  90 52.20% 33.30% 5.56% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1109263217 C -> T LOC_Os11g16710.1 upstream_gene_variant ; 1823.0bp to feature; MODIFIER silent_mutation Average:31.667; most accessible tissue: Minghui63 young leaf, score: 70.655 N N N N
vg1109263217 C -> T LOC_Os11g16720.1 upstream_gene_variant ; 1120.0bp to feature; MODIFIER silent_mutation Average:31.667; most accessible tissue: Minghui63 young leaf, score: 70.655 N N N N
vg1109263217 C -> T LOC_Os11g16730.1 downstream_gene_variant ; 3426.0bp to feature; MODIFIER silent_mutation Average:31.667; most accessible tissue: Minghui63 young leaf, score: 70.655 N N N N
vg1109263217 C -> T LOC_Os11g16710-LOC_Os11g16720 intergenic_region ; MODIFIER silent_mutation Average:31.667; most accessible tissue: Minghui63 young leaf, score: 70.655 N N N N
vg1109263217 C -> DEL N N silent_mutation Average:31.667; most accessible tissue: Minghui63 young leaf, score: 70.655 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1109263217 NA 6.46E-08 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109263217 NA 2.37E-06 mr1135 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109263217 NA 4.61E-07 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109263217 2.34E-07 2.34E-07 mr1159 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109263217 NA 2.27E-06 mr1504 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109263217 5.23E-07 2.02E-09 mr1837 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251