Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109252886:

Variant ID: vg1109252886 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 9252886
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.03, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

TATATACTTATATATAGTTCATCCTCACTTAGTTAGTGCTTAAATGATTAATCTATGGTTCAAATTATCTTTCTCCTTTTTTCCTCTAATTAAGTCATAT[T/C]
ACATCAATTATTTTTAGCCTTTAGATGATTAATCTACGGTCTAAACTATCTCCCTGCTTTTCTTCTTCCATGAAGTCATACCACCTTACTTTTTACTTTT

Reverse complement sequence

AAAAGTAAAAAGTAAGGTGGTATGACTTCATGGAAGAAGAAAAGCAGGGAGATAGTTTAGACCGTAGATTAATCATCTAAAGGCTAAAAATAATTGATGT[A/G]
ATATGACTTAATTAGAGGAAAAAAGGAGAAAGATAATTTGAACCATAGATTAATCATTTAAGCACTAACTAAGTGAGGATGAACTATATATAAGTATATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.80%	24.90%	2.86%	37.45%	NA
All Indica	2759	30.80%	3.90%	3.19%	62.12%	NA
All Japonica	1512	42.90%	52.10%	2.71%	2.25%	NA
Aus	269	9.70%	88.80%	1.12%	0.37%	NA
Indica I	595	8.20%	2.70%	6.72%	82.35%	NA
Indica II	465	59.40%	1.30%	0.65%	38.71%	NA
Indica III	913	32.10%	3.30%	1.86%	62.76%	NA
Indica Intermediate	786	29.50%	7.00%	3.56%	59.92%	NA
Temperate Japonica	767	27.00%	66.90%	3.65%	2.48%	NA
Tropical Japonica	504	71.20%	25.00%	1.39%	2.38%	NA
Japonica Intermediate	241	34.40%	61.80%	2.49%	1.24%	NA
VI/Aromatic	96	84.40%	14.60%	0.00%	1.04%	NA
Intermediate	90	43.30%	31.10%	3.33%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1109252886	T -> DEL	N	N	silent_mutation	Average:13.756; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg1109252886	T -> C	LOC_Os11g16680.1	upstream_gene_variant ; 4586.0bp to feature; MODIFIER	silent_mutation	Average:13.756; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg1109252886	T -> C	LOC_Os11g16690.1	downstream_gene_variant ; 3911.0bp to feature; MODIFIER	silent_mutation	Average:13.756; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg1109252886	T -> C	LOC_Os11g16680-LOC_Os11g16690	intergenic_region ; MODIFIER	silent_mutation	Average:13.756; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1109252886	NA	3.07E-06	mr1026	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109252886	NA	1.27E-08	mr1364	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109252886	NA	1.89E-08	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109252886	NA	2.91E-06	mr1555	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109252886	NA	8.05E-06	mr1380_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109252886	4.47E-06	4.47E-06	mr1908_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251