\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109252886:

Variant ID: vg1109252886 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 9252886
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.03, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TATATACTTATATATAGTTCATCCTCACTTAGTTAGTGCTTAAATGATTAATCTATGGTTCAAATTATCTTTCTCCTTTTTTCCTCTAATTAAGTCATAT[T/C]
ACATCAATTATTTTTAGCCTTTAGATGATTAATCTACGGTCTAAACTATCTCCCTGCTTTTCTTCTTCCATGAAGTCATACCACCTTACTTTTTACTTTT

Reverse complement sequence

AAAAGTAAAAAGTAAGGTGGTATGACTTCATGGAAGAAGAAAAGCAGGGAGATAGTTTAGACCGTAGATTAATCATCTAAAGGCTAAAAATAATTGATGT[A/G]
ATATGACTTAATTAGAGGAAAAAAGGAGAAAGATAATTTGAACCATAGATTAATCATTTAAGCACTAACTAAGTGAGGATGAACTATATATAAGTATATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.80% 24.90% 2.86% 37.45% NA
All Indica  2759 30.80% 3.90% 3.19% 62.12% NA
All Japonica  1512 42.90% 52.10% 2.71% 2.25% NA
Aus  269 9.70% 88.80% 1.12% 0.37% NA
Indica I  595 8.20% 2.70% 6.72% 82.35% NA
Indica II  465 59.40% 1.30% 0.65% 38.71% NA
Indica III  913 32.10% 3.30% 1.86% 62.76% NA
Indica Intermediate  786 29.50% 7.00% 3.56% 59.92% NA
Temperate Japonica  767 27.00% 66.90% 3.65% 2.48% NA
Tropical Japonica  504 71.20% 25.00% 1.39% 2.38% NA
Japonica Intermediate  241 34.40% 61.80% 2.49% 1.24% NA
VI/Aromatic  96 84.40% 14.60% 0.00% 1.04% NA
Intermediate  90 43.30% 31.10% 3.33% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1109252886 T -> DEL N N silent_mutation Average:13.756; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg1109252886 T -> C LOC_Os11g16680.1 upstream_gene_variant ; 4586.0bp to feature; MODIFIER silent_mutation Average:13.756; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg1109252886 T -> C LOC_Os11g16690.1 downstream_gene_variant ; 3911.0bp to feature; MODIFIER silent_mutation Average:13.756; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg1109252886 T -> C LOC_Os11g16680-LOC_Os11g16690 intergenic_region ; MODIFIER silent_mutation Average:13.756; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1109252886 NA 3.07E-06 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109252886 NA 1.27E-08 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109252886 NA 1.89E-08 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109252886 NA 2.91E-06 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109252886 NA 8.05E-06 mr1380_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109252886 4.47E-06 4.47E-06 mr1908_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251