RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1109241491:

Variant ID: vg1109241491 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 9241491
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CACAATCATTTCCTATTTAATTTTACCTATTTTTTTAATAACCGTGTCCAACTCTAAAAATGCTTATATTCTAGTACTGAGGGAGTACATAATCCTATGG[A/C]
TGTCACTAAAATATTTCGACAGCTTTCCAAAATTCTCATATGTATCCAATTCAATTGTTGCACACTTAGTAGGCAGCTGTAAGCCCCCGGCATGGTGTTG

Reverse complement sequence

CAACACCATGCCGGGGGCTTACAGCTGCCTACTAAGTGTGCAACAATTGAATTGGATACATATGAGAATTTTGGAAAGCTGTCGAAATATTTTAGTGACA[T/G]
CCATAGGATTATGTACTCCCTCAGTACTAGAATATAAGCATTTTTAGAGTTGGACACGGTTATTAAAAAAATAGGTAAAATTAAATAGGAAATGATTGTG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.90%	21.60%	1.95%	2.54%	NA
All Indica	2759	93.40%	2.50%	0.33%	3.73%	NA
All Japonica	1512	48.70%	45.20%	5.09%	0.93%	NA
Aus	269	10.40%	89.20%	0.37%	0.00%	NA
Indica I	595	95.10%	0.30%	0.17%	4.37%	NA
Indica II	465	90.10%	1.10%	0.65%	8.17%	NA
Indica III	913	96.80%	3.10%	0.00%	0.11%	NA
Indica Intermediate	786	90.20%	4.30%	0.64%	4.83%	NA
Temperate Japonica	767	29.50%	61.70%	7.17%	1.69%	NA
Tropical Japonica	504	82.90%	14.50%	2.38%	0.20%	NA
Japonica Intermediate	241	38.60%	57.30%	4.15%	0.00%	NA
VI/Aromatic	96	87.50%	8.30%	2.08%	2.08%	NA
Intermediate	90	74.40%	21.10%	3.33%	1.11%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1109241491	A -> DEL	LOC_Os11g16670.1	N	frameshift_variant	Average:51.701; most accessible tissue: Zhenshan97 young leaf, score: 65.28	N	N	N	N
vg1109241491	A -> C	LOC_Os11g16670.1	missense_variant ; p.Ile199Ser; MODERATE	nonsynonymous_codon ; I199S	Average:51.701; most accessible tissue: Zhenshan97 young leaf, score: 65.28	unknown	unknown	TOLERATED	1.00

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1109241491	8.05E-06	9.55E-09	mr1026	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109241491	NA	1.08E-06	mr1161	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109241491	NA	7.57E-07	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109241491	NA	1.12E-06	mr1555	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109241491	NA	4.69E-09	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 5 of 5 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg1109241491:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact