Variant ID: vg1109209726 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 9209726 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 222. )
CCTTCCTTTTGGGTATAACCCTTGGCCACAAGTCTTGCCTTGTACTTTTCAATTGTACCATCAGGCCGAAGCTTTTTCTTGAAAACTCATTTGCATCCTA[C/T]
GGGCTTGCACCCATATGGACGCTCAACGACTTCCCAAGTGCCATTAGACATAATCGAGTCCATCTCACTGCGTACTGCTTCCTTCCAGTAGTCAGCGTCA
TGACGCTGACTACTGGAAGGAAGCAGTACGCAGTGAGATGGACTCGATTATGTCTAATGGCACTTGGGAAGTCGTTGAGCGTCCATATGGGTGCAAGCCC[G/A]
TAGGATGCAAATGAGTTTTCAAGAAAAAGCTTCGGCCTGATGGTACAATTGAAAAGTACAAGGCAAGACTTGTGGCCAAGGGTTATACCCAAAAGGAAGG
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 61.90% | 31.50% | 6.67% | 0.00% | NA |
All Indica | 2759 | 37.40% | 52.00% | 10.66% | 0.00% | NA |
All Japonica | 1512 | 97.70% | 1.90% | 0.46% | 0.00% | NA |
Aus | 269 | 94.40% | 2.20% | 3.35% | 0.00% | NA |
Indica I | 595 | 13.10% | 73.90% | 12.94% | 0.00% | NA |
Indica II | 465 | 61.50% | 28.40% | 10.11% | 0.00% | NA |
Indica III | 913 | 39.40% | 53.70% | 6.90% | 0.00% | NA |
Indica Intermediate | 786 | 39.10% | 47.30% | 13.61% | 0.00% | NA |
Temperate Japonica | 767 | 97.40% | 1.80% | 0.78% | 0.00% | NA |
Tropical Japonica | 504 | 97.60% | 2.20% | 0.20% | 0.00% | NA |
Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
Intermediate | 90 | 75.60% | 18.90% | 5.56% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1109209726 | C -> T | LOC_Os11g16610.1 | splice_donor_variant&intron_variant ; HIGH | splice_donor_variant | Average:19.232; most accessible tissue: Minghui63 young leaf, score: 44.63 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1109209726 | NA | 1.89E-07 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1109209726 | NA | 5.07E-06 | mr1077 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1109209726 | NA | 5.89E-06 | mr1135 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1109209726 | NA | 9.55E-06 | mr1482 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1109209726 | NA | 1.76E-07 | mr1504 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1109209726 | NA | 4.48E-06 | mr1715 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1109209726 | NA | 6.25E-09 | mr1837 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1109209726 | 1.88E-06 | 2.44E-08 | mr1837 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |