\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109141672:

Variant ID: vg1109141672 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 9141672
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAACGGCTAATTTGGCCCCTGTTTTTTCGAGTTTGCTCATTTGATCCTTTTTTAGAAACGAAGATAAGACTTGGCCCTATTCCGTGAAGGCAACATGATG[T/G]
TGTTAACTCAAGACAAATATTCCATTTGTACCCTTATGAATTTAACCCAATTTCTCAAAGTATTTTATTCAATGCAGTTTTGTGCACTTATTAGTATATA

Reverse complement sequence

TATATACTAATAAGTGCACAAAACTGCATTGAATAAAATACTTTGAGAAATTGGGTTAAATTCATAAGGGTACAAATGGAATATTTGTCTTGAGTTAACA[A/C]
CATCATGTTGCCTTCACGGAATAGGGCCAAGTCTTATCTTCGTTTCTAAAAAAGGATCAAATGAGCAAACTCGAAAAAACAGGGGCCAAATTAGCCGTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.40% 40.60% 0.00% 0.00% NA
All Indica  2759 96.00% 4.00% 0.00% 0.00% NA
All Japonica  1512 3.60% 96.40% 0.00% 0.00% NA
Aus  269 11.20% 88.80% 0.00% 0.00% NA
Indica I  595 99.00% 1.00% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 96.30% 3.70% 0.00% 0.00% NA
Indica Intermediate  786 91.60% 8.40% 0.00% 0.00% NA
Temperate Japonica  767 1.80% 98.20% 0.00% 0.00% NA
Tropical Japonica  504 6.20% 93.80% 0.00% 0.00% NA
Japonica Intermediate  241 3.70% 96.30% 0.00% 0.00% NA
VI/Aromatic  96 20.80% 79.20% 0.00% 0.00% NA
Intermediate  90 60.00% 40.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1109141672 T -> G LOC_Os11g16510.1 upstream_gene_variant ; 3835.0bp to feature; MODIFIER silent_mutation Average:48.811; most accessible tissue: Zhenshan97 root, score: 83.426 N N N N
vg1109141672 T -> G LOC_Os11g16530.1 upstream_gene_variant ; 2546.0bp to feature; MODIFIER silent_mutation Average:48.811; most accessible tissue: Zhenshan97 root, score: 83.426 N N N N
vg1109141672 T -> G LOC_Os11g16530.2 upstream_gene_variant ; 2505.0bp to feature; MODIFIER silent_mutation Average:48.811; most accessible tissue: Zhenshan97 root, score: 83.426 N N N N
vg1109141672 T -> G LOC_Os11g16520.1 downstream_gene_variant ; 463.0bp to feature; MODIFIER silent_mutation Average:48.811; most accessible tissue: Zhenshan97 root, score: 83.426 N N N N
vg1109141672 T -> G LOC_Os11g16510-LOC_Os11g16520 intergenic_region ; MODIFIER silent_mutation Average:48.811; most accessible tissue: Zhenshan97 root, score: 83.426 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1109141672 NA 1.25E-46 mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672 NA 1.36E-14 mr1199 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672 NA 2.20E-10 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672 NA 5.28E-10 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672 NA 4.65E-11 mr1883 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672 NA 5.42E-15 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672 NA 3.66E-49 mr1063_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672 1.13E-06 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672 9.09E-07 NA mr1080_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672 NA 1.67E-45 mr1094_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672 5.39E-06 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672 NA 8.16E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672 NA 1.20E-23 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672 NA 1.44E-08 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672 NA 6.76E-47 mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672 NA 3.41E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672 NA 5.34E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672 NA 4.24E-29 mr1932_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672 NA 1.05E-25 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251