Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109141672:

Variant ID: vg1109141672 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 9141672
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAACGGCTAATTTGGCCCCTGTTTTTTCGAGTTTGCTCATTTGATCCTTTTTTAGAAACGAAGATAAGACTTGGCCCTATTCCGTGAAGGCAACATGATG[T/G]
TGTTAACTCAAGACAAATATTCCATTTGTACCCTTATGAATTTAACCCAATTTCTCAAAGTATTTTATTCAATGCAGTTTTGTGCACTTATTAGTATATA

Reverse complement sequence

TATATACTAATAAGTGCACAAAACTGCATTGAATAAAATACTTTGAGAAATTGGGTTAAATTCATAAGGGTACAAATGGAATATTTGTCTTGAGTTAACA[A/C]
CATCATGTTGCCTTCACGGAATAGGGCCAAGTCTTATCTTCGTTTCTAAAAAAGGATCAAATGAGCAAACTCGAAAAAACAGGGGCCAAATTAGCCGTTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.40%	40.60%	0.00%	0.00%	NA
All Indica	2759	96.00%	4.00%	0.00%	0.00%	NA
All Japonica	1512	3.60%	96.40%	0.00%	0.00%	NA
Aus	269	11.20%	88.80%	0.00%	0.00%	NA
Indica I	595	99.00%	1.00%	0.00%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	96.30%	3.70%	0.00%	0.00%	NA
Indica Intermediate	786	91.60%	8.40%	0.00%	0.00%	NA
Temperate Japonica	767	1.80%	98.20%	0.00%	0.00%	NA
Tropical Japonica	504	6.20%	93.80%	0.00%	0.00%	NA
Japonica Intermediate	241	3.70%	96.30%	0.00%	0.00%	NA
VI/Aromatic	96	20.80%	79.20%	0.00%	0.00%	NA
Intermediate	90	60.00%	40.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1109141672	T -> G	LOC_Os11g16510.1	upstream_gene_variant ; 3835.0bp to feature; MODIFIER	silent_mutation	Average:48.811; most accessible tissue: Zhenshan97 root, score: 83.426	N	N	N	N
vg1109141672	T -> G	LOC_Os11g16530.1	upstream_gene_variant ; 2546.0bp to feature; MODIFIER	silent_mutation	Average:48.811; most accessible tissue: Zhenshan97 root, score: 83.426	N	N	N	N
vg1109141672	T -> G	LOC_Os11g16530.2	upstream_gene_variant ; 2505.0bp to feature; MODIFIER	silent_mutation	Average:48.811; most accessible tissue: Zhenshan97 root, score: 83.426	N	N	N	N
vg1109141672	T -> G	LOC_Os11g16520.1	downstream_gene_variant ; 463.0bp to feature; MODIFIER	silent_mutation	Average:48.811; most accessible tissue: Zhenshan97 root, score: 83.426	N	N	N	N
vg1109141672	T -> G	LOC_Os11g16510-LOC_Os11g16520	intergenic_region ; MODIFIER	silent_mutation	Average:48.811; most accessible tissue: Zhenshan97 root, score: 83.426	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1109141672	NA	1.25E-46	mr1109	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672	NA	1.36E-14	mr1199	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672	NA	2.20E-10	mr1524	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672	NA	5.28E-10	mr1720	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672	NA	4.65E-11	mr1883	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672	NA	5.42E-15	mr1916	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672	NA	3.66E-49	mr1063_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672	1.13E-06	NA	mr1071_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672	9.09E-07	NA	mr1080_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672	NA	1.67E-45	mr1094_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672	5.39E-06	NA	mr1203_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672	NA	8.16E-10	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672	NA	1.20E-23	mr1422_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672	NA	1.44E-08	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672	NA	6.76E-47	mr1793_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672	NA	3.41E-07	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672	NA	5.34E-21	mr1924_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672	NA	4.24E-29	mr1932_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109141672	NA	1.05E-25	mr1943_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251