\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109129387:

Variant ID: vg1109129387 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 9129387
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.64, C: 0.35, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


AAATCCTCGGTTGTCGATGACTATCCTTCCATGAGGAGCATGCCCTGTAAATACGAGGCGGAGAAAGAGCAGAGTGGAGATTCCTTTGAGTATGTTAATG[T/C]
CACTCTTCTCCATTCCTGAGATGTACAGTTGCAGGTGTATGAGATTGTCAAATATGCTAATCCACTCTGGCACCCTGGCAAGAGTTTTCCCAATGATAAG

Reverse complement sequence

CTTATCATTGGGAAAACTCTTGCCAGGGTGCCAGAGTGGATTAGCATATTTGACAATCTCATACACCTGCAACTGTACATCTCAGGAATGGAGAAGAGTG[A/G]
CATTAACATACTCAAAGGAATCTCCACTCTGCTCTTTCTCCGCCTCGTATTTACAGGGCATGCTCCTCATGGAAGGATAGTCATCGACAACCGAGGATTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.90% 41.00% 0.66% 8.44% NA
All Indica  2759 80.60% 4.50% 1.09% 13.85% NA
All Japonica  1512 3.30% 96.60% 0.00% 0.07% NA
Aus  269 11.20% 88.80% 0.00% 0.00% NA
Indica I  595 98.80% 0.80% 0.34% 0.00% NA
Indica II  465 49.00% 1.90% 0.65% 48.39% NA
Indica III  913 88.80% 4.50% 2.08% 4.60% NA
Indica Intermediate  786 76.00% 8.70% 0.76% 14.63% NA
Temperate Japonica  767 1.70% 98.30% 0.00% 0.00% NA
Tropical Japonica  504 5.60% 94.20% 0.00% 0.20% NA
Japonica Intermediate  241 3.70% 96.30% 0.00% 0.00% NA
VI/Aromatic  96 20.80% 79.20% 0.00% 0.00% NA
Intermediate  90 35.60% 45.60% 1.11% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1109129387 T -> DEL N N silent_mutation Average:46.02; most accessible tissue: Zhenshan97 root, score: 66.982 N N N N
vg1109129387 T -> C LOC_Os11g16480-LOC_Os11g16500 intergenic_region ; MODIFIER silent_mutation Average:46.02; most accessible tissue: Zhenshan97 root, score: 66.982 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1109129387 NA 1.15E-08 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109129387 NA 1.62E-11 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109129387 NA 2.62E-06 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109129387 NA 2.78E-12 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109129387 NA 3.56E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109129387 NA 6.08E-07 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109129387 NA 2.90E-08 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109129387 NA 4.18E-12 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109129387 NA 9.77E-12 mr1902 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109129387 NA 7.76E-09 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109129387 NA 7.79E-08 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109129387 NA 4.97E-07 mr1154_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109129387 NA 1.21E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109129387 NA 5.88E-11 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109129387 NA 8.80E-07 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109129387 NA 2.96E-09 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109129387 NA 5.73E-10 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251