\
| Variant ID: vg1109060930 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 9060930 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 117. )
AGTGGCAAAAAGTTAATTGCCACATCTAAATGTGGCAAATGGTTAAATATCTCTTTATTTACCTGCATGATATCATCAGGCTTTCATTTACCTATATCTT[C/T]
TTTAAATTTATTGGACAACCTGATCGCAAATAAATGACATATATTTTAGTTGTGATAATTAAGAATTAACATTTAGTTACCAGACGTCCATCATTGATAT
ATATCAATGATGGACGTCTGGTAACTAAATGTTAATTCTTAATTATCACAACTAAAATATATGTCATTTATTTGCGATCAGGTTGTCCAATAAATTTAAA[G/A]
AAGATATAGGTAAATGAAAGCCTGATGATATCATGCAGGTAAATAAAGAGATATTTAACCATTTGCCACATTTAGATGTGGCAATTAACTTTTTGCCACT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.00% | 21.90% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 64.20% | 35.70% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 93.70% | 6.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 77.10% | 22.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 60.60% | 39.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 58.20% | 41.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 63.60% | 36.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 21.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1109060930 | C -> T | LOC_Os11g16390.1 | upstream_gene_variant ; 1563.0bp to feature; MODIFIER | silent_mutation | Average:52.481; most accessible tissue: Zhenshan97 flower, score: 78.677 | N | N | N | N |
| vg1109060930 | C -> T | LOC_Os11g16390.2 | upstream_gene_variant ; 1573.0bp to feature; MODIFIER | silent_mutation | Average:52.481; most accessible tissue: Zhenshan97 flower, score: 78.677 | N | N | N | N |
| vg1109060930 | C -> T | LOC_Os11g16390.3 | upstream_gene_variant ; 1563.0bp to feature; MODIFIER | silent_mutation | Average:52.481; most accessible tissue: Zhenshan97 flower, score: 78.677 | N | N | N | N |
| vg1109060930 | C -> T | LOC_Os11g16400.1 | downstream_gene_variant ; 4224.0bp to feature; MODIFIER | silent_mutation | Average:52.481; most accessible tissue: Zhenshan97 flower, score: 78.677 | N | N | N | N |
| vg1109060930 | C -> T | LOC_Os11g16390-LOC_Os11g16400 | intergenic_region ; MODIFIER | silent_mutation | Average:52.481; most accessible tissue: Zhenshan97 flower, score: 78.677 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1109060930 | NA | 4.65E-06 | mr1135 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109060930 | NA | 9.63E-06 | mr1285 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109060930 | NA | 3.69E-08 | mr1504 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109060930 | NA | 7.14E-08 | mr1951 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |