\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109060930:

Variant ID: vg1109060930 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 9060930
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


AGTGGCAAAAAGTTAATTGCCACATCTAAATGTGGCAAATGGTTAAATATCTCTTTATTTACCTGCATGATATCATCAGGCTTTCATTTACCTATATCTT[C/T]
TTTAAATTTATTGGACAACCTGATCGCAAATAAATGACATATATTTTAGTTGTGATAATTAAGAATTAACATTTAGTTACCAGACGTCCATCATTGATAT

Reverse complement sequence

ATATCAATGATGGACGTCTGGTAACTAAATGTTAATTCTTAATTATCACAACTAAAATATATGTCATTTATTTGCGATCAGGTTGTCCAATAAATTTAAA[G/A]
AAGATATAGGTAAATGAAAGCCTGATGATATCATGCAGGTAAATAAAGAGATATTTAACCATTTGCCACATTTAGATGTGGCAATTAACTTTTTGCCACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.00% 21.90% 0.08% 0.00% NA
All Indica  2759 64.20% 35.70% 0.11% 0.00% NA
All Japonica  1512 99.10% 0.90% 0.00% 0.00% NA
Aus  269 93.70% 6.30% 0.00% 0.00% NA
Indica I  595 77.10% 22.70% 0.17% 0.00% NA
Indica II  465 60.60% 39.40% 0.00% 0.00% NA
Indica III  913 58.20% 41.70% 0.11% 0.00% NA
Indica Intermediate  786 63.60% 36.30% 0.13% 0.00% NA
Temperate Japonica  767 98.80% 1.20% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 77.80% 21.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1109060930 C -> T LOC_Os11g16390.1 upstream_gene_variant ; 1563.0bp to feature; MODIFIER silent_mutation Average:52.481; most accessible tissue: Zhenshan97 flower, score: 78.677 N N N N
vg1109060930 C -> T LOC_Os11g16390.2 upstream_gene_variant ; 1573.0bp to feature; MODIFIER silent_mutation Average:52.481; most accessible tissue: Zhenshan97 flower, score: 78.677 N N N N
vg1109060930 C -> T LOC_Os11g16390.3 upstream_gene_variant ; 1563.0bp to feature; MODIFIER silent_mutation Average:52.481; most accessible tissue: Zhenshan97 flower, score: 78.677 N N N N
vg1109060930 C -> T LOC_Os11g16400.1 downstream_gene_variant ; 4224.0bp to feature; MODIFIER silent_mutation Average:52.481; most accessible tissue: Zhenshan97 flower, score: 78.677 N N N N
vg1109060930 C -> T LOC_Os11g16390-LOC_Os11g16400 intergenic_region ; MODIFIER silent_mutation Average:52.481; most accessible tissue: Zhenshan97 flower, score: 78.677 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1109060930 NA 4.65E-06 mr1135 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109060930 NA 9.63E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109060930 NA 3.69E-08 mr1504 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109060930 NA 7.14E-08 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251