Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109060541:

Variant ID: vg1109060541 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 9060541
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCCGAGACGCGTATGAATTAATTAGGCTAGCACCTTTTCACGCGCCCCTTGCCGCTTGCAGCGATCAGGTCCACATGCGCCTTTGTGCGCCGCTGTGATT[G/A]
GACCCACAACGCCCTCACGCATGATTTTTTTTGCATGCCTGATTGGGTCCGCGACGTCCTCGTAAATCTACCTTATTAGCATATAAGCACTTTAAGGGAA

Reverse complement sequence

TTCCCTTAAAGTGCTTATATGCTAATAAGGTAGATTTACGAGGACGTCGCGGACCCAATCAGGCATGCAAAAAAAATCATGCGTGAGGGCGTTGTGGGTC[C/T]
AATCACAGCGGCGCACAAAGGCGCATGTGGACCTGATCGCTGCAAGCGGCAAGGGGCGCGTGAAAAGGTGCTAGCCTAATTAATTCATACGCGTCTCGGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.90%	6.10%	0.00%	0.00%	NA
All Indica	2759	90.70%	9.30%	0.00%	0.00%	NA
All Japonica	1512	99.80%	0.20%	0.00%	0.00%	NA
Aus	269	91.80%	8.20%	0.00%	0.00%	NA
Indica I	595	95.80%	4.20%	0.00%	0.00%	NA
Indica II	465	95.90%	4.10%	0.00%	0.00%	NA
Indica III	913	81.40%	18.60%	0.00%	0.00%	NA
Indica Intermediate	786	94.50%	5.50%	0.00%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1109060541	G -> A	LOC_Os11g16390.1	upstream_gene_variant ; 1174.0bp to feature; MODIFIER	silent_mutation	Average:65.241; most accessible tissue: Minghui63 flag leaf, score: 77.153	N	N	N	N
vg1109060541	G -> A	LOC_Os11g16390.2	upstream_gene_variant ; 1184.0bp to feature; MODIFIER	silent_mutation	Average:65.241; most accessible tissue: Minghui63 flag leaf, score: 77.153	N	N	N	N
vg1109060541	G -> A	LOC_Os11g16390.3	upstream_gene_variant ; 1174.0bp to feature; MODIFIER	silent_mutation	Average:65.241; most accessible tissue: Minghui63 flag leaf, score: 77.153	N	N	N	N
vg1109060541	G -> A	LOC_Os11g16400.1	downstream_gene_variant ; 4613.0bp to feature; MODIFIER	silent_mutation	Average:65.241; most accessible tissue: Minghui63 flag leaf, score: 77.153	N	N	N	N
vg1109060541	G -> A	LOC_Os11g16390-LOC_Os11g16400	intergenic_region ; MODIFIER	silent_mutation	Average:65.241; most accessible tissue: Minghui63 flag leaf, score: 77.153	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1109060541	NA	1.69E-06	mr1210	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251