\
| Variant ID: vg1108800737 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 8800737 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.71, G: 0.28, others allele: 0.00, population size: 80. )
GGGCTAAAAACAATTATGGTGTTGTGGCTTCATGAGAGAAGAGAGAATTAGCATTAGCTATACTTATTTTGGGAATGAACTTTATAGATATATAGGATAA[A/G]
GGAGTAGCCACTCTGATAAGTTCTTTAGAAAGCTACTAAAATGCTTAATATATAGTATACAATATACTTGATCAATTATTACGAGGTATATCCACACTAC
GTAGTGTGGATATACCTCGTAATAATTGATCAAGTATATTGTATACTATATATTAAGCATTTTAGTAGCTTTCTAAAGAACTTATCAGAGTGGCTACTCC[T/C]
TTATCCTATATATCTATAAAGTTCATTCCCAAAATAAGTATAGCTAATGCTAATTCTCTCTTCTCTCATGAAGCCACAACACCATAATTGTTTTTAGCCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.70% | 36.60% | 2.24% | 20.38% | NA |
| All Indica | 2759 | 61.40% | 3.50% | 2.61% | 32.48% | NA |
| All Japonica | 1512 | 6.90% | 89.70% | 0.60% | 2.84% | NA |
| Aus | 269 | 34.20% | 58.40% | 5.20% | 2.23% | NA |
| Indica I | 595 | 77.50% | 0.70% | 1.51% | 20.34% | NA |
| Indica II | 465 | 45.80% | 1.30% | 0.65% | 52.26% | NA |
| Indica III | 913 | 63.10% | 4.70% | 5.04% | 27.16% | NA |
| Indica Intermediate | 786 | 56.50% | 5.60% | 1.78% | 36.13% | NA |
| Temperate Japonica | 767 | 2.00% | 98.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 15.10% | 80.20% | 0.79% | 3.97% | NA |
| Japonica Intermediate | 241 | 5.40% | 83.00% | 2.07% | 9.54% | NA |
| VI/Aromatic | 96 | 0.00% | 91.70% | 6.25% | 2.08% | NA |
| Intermediate | 90 | 38.90% | 37.80% | 5.56% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1108800737 | A -> DEL | N | N | silent_mutation | Average:18.82; most accessible tissue: Zhenshan97 flag leaf, score: 34.199 | N | N | N | N |
| vg1108800737 | A -> G | LOC_Os11g15520.1 | upstream_gene_variant ; 2588.0bp to feature; MODIFIER | silent_mutation | Average:18.82; most accessible tissue: Zhenshan97 flag leaf, score: 34.199 | N | N | N | N |
| vg1108800737 | A -> G | LOC_Os11g15540.1 | upstream_gene_variant ; 4253.0bp to feature; MODIFIER | silent_mutation | Average:18.82; most accessible tissue: Zhenshan97 flag leaf, score: 34.199 | N | N | N | N |
| vg1108800737 | A -> G | LOC_Os11g15530.1 | downstream_gene_variant ; 2628.0bp to feature; MODIFIER | silent_mutation | Average:18.82; most accessible tissue: Zhenshan97 flag leaf, score: 34.199 | N | N | N | N |
| vg1108800737 | A -> G | LOC_Os11g15520-LOC_Os11g15530 | intergenic_region ; MODIFIER | silent_mutation | Average:18.82; most accessible tissue: Zhenshan97 flag leaf, score: 34.199 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1108800737 | NA | 2.24E-06 | mr1027 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108800737 | NA | 5.69E-10 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108800737 | NA | 1.61E-11 | mr1188 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108800737 | NA | 2.55E-06 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108800737 | 4.40E-06 | NA | mr1931 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108800737 | 1.22E-06 | 5.29E-06 | mr1931 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108800737 | NA | 3.20E-12 | mr1188_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108800737 | NA | 6.86E-07 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108800737 | NA | 5.53E-13 | mr1217_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108800737 | NA | 8.15E-09 | mr1835_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108800737 | NA | 1.78E-07 | mr1885_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108800737 | NA | 6.18E-21 | mr1924_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |