\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1108800737:

Variant ID: vg1108800737 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 8800737
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.71, G: 0.28, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


GGGCTAAAAACAATTATGGTGTTGTGGCTTCATGAGAGAAGAGAGAATTAGCATTAGCTATACTTATTTTGGGAATGAACTTTATAGATATATAGGATAA[A/G]
GGAGTAGCCACTCTGATAAGTTCTTTAGAAAGCTACTAAAATGCTTAATATATAGTATACAATATACTTGATCAATTATTACGAGGTATATCCACACTAC

Reverse complement sequence

GTAGTGTGGATATACCTCGTAATAATTGATCAAGTATATTGTATACTATATATTAAGCATTTTAGTAGCTTTCTAAAGAACTTATCAGAGTGGCTACTCC[T/C]
TTATCCTATATATCTATAAAGTTCATTCCCAAAATAAGTATAGCTAATGCTAATTCTCTCTTCTCTCATGAAGCCACAACACCATAATTGTTTTTAGCCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.70% 36.60% 2.24% 20.38% NA
All Indica  2759 61.40% 3.50% 2.61% 32.48% NA
All Japonica  1512 6.90% 89.70% 0.60% 2.84% NA
Aus  269 34.20% 58.40% 5.20% 2.23% NA
Indica I  595 77.50% 0.70% 1.51% 20.34% NA
Indica II  465 45.80% 1.30% 0.65% 52.26% NA
Indica III  913 63.10% 4.70% 5.04% 27.16% NA
Indica Intermediate  786 56.50% 5.60% 1.78% 36.13% NA
Temperate Japonica  767 2.00% 98.00% 0.00% 0.00% NA
Tropical Japonica  504 15.10% 80.20% 0.79% 3.97% NA
Japonica Intermediate  241 5.40% 83.00% 2.07% 9.54% NA
VI/Aromatic  96 0.00% 91.70% 6.25% 2.08% NA
Intermediate  90 38.90% 37.80% 5.56% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1108800737 A -> DEL N N silent_mutation Average:18.82; most accessible tissue: Zhenshan97 flag leaf, score: 34.199 N N N N
vg1108800737 A -> G LOC_Os11g15520.1 upstream_gene_variant ; 2588.0bp to feature; MODIFIER silent_mutation Average:18.82; most accessible tissue: Zhenshan97 flag leaf, score: 34.199 N N N N
vg1108800737 A -> G LOC_Os11g15540.1 upstream_gene_variant ; 4253.0bp to feature; MODIFIER silent_mutation Average:18.82; most accessible tissue: Zhenshan97 flag leaf, score: 34.199 N N N N
vg1108800737 A -> G LOC_Os11g15530.1 downstream_gene_variant ; 2628.0bp to feature; MODIFIER silent_mutation Average:18.82; most accessible tissue: Zhenshan97 flag leaf, score: 34.199 N N N N
vg1108800737 A -> G LOC_Os11g15520-LOC_Os11g15530 intergenic_region ; MODIFIER silent_mutation Average:18.82; most accessible tissue: Zhenshan97 flag leaf, score: 34.199 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1108800737 NA 2.24E-06 mr1027 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108800737 NA 5.69E-10 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108800737 NA 1.61E-11 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108800737 NA 2.55E-06 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108800737 4.40E-06 NA mr1931 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108800737 1.22E-06 5.29E-06 mr1931 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108800737 NA 3.20E-12 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108800737 NA 6.86E-07 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108800737 NA 5.53E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108800737 NA 8.15E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108800737 NA 1.78E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108800737 NA 6.18E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251