\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1108796428:

Variant ID: vg1108796428 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 8796428
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGGAAAGGAAAATAGAGCGAGGCACGATCATGGAGTACCCTGGGTGCAGCCTTTCTCACCTTTCTCTGCTCATGGCCTCTCCCACCTTTTCAATTCCTT[C/T]
TAAGTTCTAAGTCTTCCCACTGCCACCATCTCACCTTCAGAGTTCAGACAATTCATCGAACACCTTGTGTGCACGCGGCAAAGACAAGCACGAATCGTTT

Reverse complement sequence

AAACGATTCGTGCTTGTCTTTGCCGCGTGCACACAAGGTGTTCGATGAATTGTCTGAACTCTGAAGGTGAGATGGTGGCAGTGGGAAGACTTAGAACTTA[G/A]
AAGGAATTGAAAAGGTGGGAGAGGCCATGAGCAGAGAAAGGTGAGAAAGGCTGCACCCAGGGTACTCCATGATCGTGCCTCGCTCTATTTTCCTTTCCAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.10% 40.80% 0.11% 0.00% NA
All Indica  2759 90.40% 9.50% 0.14% 0.00% NA
All Japonica  1512 10.10% 89.90% 0.00% 0.00% NA
Aus  269 33.10% 66.90% 0.00% 0.00% NA
Indica I  595 97.10% 2.40% 0.50% 0.00% NA
Indica II  465 98.30% 1.50% 0.22% 0.00% NA
Indica III  913 83.00% 17.00% 0.00% 0.00% NA
Indica Intermediate  786 89.10% 10.90% 0.00% 0.00% NA
Temperate Japonica  767 2.00% 98.00% 0.00% 0.00% NA
Tropical Japonica  504 19.20% 80.80% 0.00% 0.00% NA
Japonica Intermediate  241 17.00% 83.00% 0.00% 0.00% NA
VI/Aromatic  96 8.30% 91.70% 0.00% 0.00% NA
Intermediate  90 54.40% 44.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1108796428 C -> T LOC_Os11g15520.1 intron_variant ; MODIFIER silent_mutation Average:85.037; most accessible tissue: Minghui63 flag leaf, score: 92.741 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1108796428 C T -0.03 -0.04 -0.03 0.01 0.0 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1108796428 NA 3.19E-48 mr1125 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108796428 NA 8.80E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108796428 NA 5.05E-09 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108796428 2.82E-06 5.69E-13 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108796428 NA 1.97E-08 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108796428 NA 6.73E-14 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108796428 NA 5.98E-22 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108796428 NA 4.39E-63 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108796428 5.92E-06 1.11E-15 mr1188_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108796428 NA 2.13E-09 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108796428 NA 5.85E-22 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108796428 NA 1.41E-31 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108796428 NA 1.54E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108796428 NA 1.42E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108796428 NA 6.85E-25 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251