\
| Variant ID: vg1108783862 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 8783862 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.04, others allele: 0.00, population size: 113. )
ATGATTGTACTACTGAAATTTCTAGCTGGCCCCTATATTTTACTCTTCAATTTGATGCAAAATTGAGCTTCTGTCTTTTTTTTTAAAAAAAAAAGTAGAT[T/C]
CCCTATAAGGGAAAACCTCACAACTCAGCAAAACATCCCATTACTGCTGCGCCTAAGGGTGACATATGAGAACCTCAGTTAATGTGACTATGCCACCATC
GATGGTGGCATAGTCACATTAACTGAGGTTCTCATATGTCACCCTTAGGCGCAGCAGTAATGGGATGTTTTGCTGAGTTGTGAGGTTTTCCCTTATAGGG[A/G]
ATCTACTTTTTTTTTTAAAAAAAAAGACAGAAGCTCAATTTTGCATCAAATTGAAGAGTAAAATATAGGGGCCAGCTAGAAATTTCAGTAGTACAATCAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.00% | 22.80% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 66.00% | 33.80% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 92.00% | 8.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 77.80% | 22.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 44.10% | 55.30% | 0.65% | 0.00% | NA |
| Indica III | 913 | 71.60% | 28.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 63.50% | 36.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 82.90% | 17.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.90% | 14.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 20.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1108783862 | T -> C | LOC_Os11g15500.1 | downstream_gene_variant ; 747.0bp to feature; MODIFIER | silent_mutation | Average:46.64; most accessible tissue: Zhenshan97 flower, score: 70.756 | N | N | N | N |
| vg1108783862 | T -> C | LOC_Os11g15510.1 | downstream_gene_variant ; 235.0bp to feature; MODIFIER | silent_mutation | Average:46.64; most accessible tissue: Zhenshan97 flower, score: 70.756 | N | N | N | N |
| vg1108783862 | T -> C | LOC_Os11g15500-LOC_Os11g15510 | intergenic_region ; MODIFIER | silent_mutation | Average:46.64; most accessible tissue: Zhenshan97 flower, score: 70.756 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1108783862 | NA | 2.34E-06 | mr1121 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108783862 | 2.99E-06 | 2.93E-08 | mr1125 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108783862 | 4.38E-07 | 2.07E-11 | mr1136 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108783862 | 1.84E-07 | 2.68E-10 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108783862 | 8.51E-06 | 2.18E-08 | mr1448 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108783862 | NA | 1.19E-09 | mr1125_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108783862 | 7.73E-08 | 5.88E-14 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108783862 | NA | 9.85E-07 | mr1217_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108783862 | NA | 8.36E-06 | mr1218_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |