\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1108783862:

Variant ID: vg1108783862 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 8783862
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.04, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


ATGATTGTACTACTGAAATTTCTAGCTGGCCCCTATATTTTACTCTTCAATTTGATGCAAAATTGAGCTTCTGTCTTTTTTTTTAAAAAAAAAAGTAGAT[T/C]
CCCTATAAGGGAAAACCTCACAACTCAGCAAAACATCCCATTACTGCTGCGCCTAAGGGTGACATATGAGAACCTCAGTTAATGTGACTATGCCACCATC

Reverse complement sequence

GATGGTGGCATAGTCACATTAACTGAGGTTCTCATATGTCACCCTTAGGCGCAGCAGTAATGGGATGTTTTGCTGAGTTGTGAGGTTTTCCCTTATAGGG[A/G]
ATCTACTTTTTTTTTTAAAAAAAAAGACAGAAGCTCAATTTTGCATCAAATTGAAGAGTAAAATATAGGGGCCAGCTAGAAATTTCAGTAGTACAATCAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.00% 22.80% 0.13% 0.00% NA
All Indica  2759 66.00% 33.80% 0.18% 0.00% NA
All Japonica  1512 92.00% 8.00% 0.00% 0.00% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 77.80% 22.00% 0.17% 0.00% NA
Indica II  465 44.10% 55.30% 0.65% 0.00% NA
Indica III  913 71.60% 28.40% 0.00% 0.00% NA
Indica Intermediate  786 63.50% 36.40% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 82.90% 17.10% 0.00% 0.00% NA
Japonica Intermediate  241 85.90% 14.10% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 78.90% 20.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1108783862 T -> C LOC_Os11g15500.1 downstream_gene_variant ; 747.0bp to feature; MODIFIER silent_mutation Average:46.64; most accessible tissue: Zhenshan97 flower, score: 70.756 N N N N
vg1108783862 T -> C LOC_Os11g15510.1 downstream_gene_variant ; 235.0bp to feature; MODIFIER silent_mutation Average:46.64; most accessible tissue: Zhenshan97 flower, score: 70.756 N N N N
vg1108783862 T -> C LOC_Os11g15500-LOC_Os11g15510 intergenic_region ; MODIFIER silent_mutation Average:46.64; most accessible tissue: Zhenshan97 flower, score: 70.756 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1108783862 NA 2.34E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108783862 2.99E-06 2.93E-08 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108783862 4.38E-07 2.07E-11 mr1136 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108783862 1.84E-07 2.68E-10 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108783862 8.51E-06 2.18E-08 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108783862 NA 1.19E-09 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108783862 7.73E-08 5.88E-14 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108783862 NA 9.85E-07 mr1217_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108783862 NA 8.36E-06 mr1218_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251