Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1108783862:

Variant ID: vg1108783862 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 8783862
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.04, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

ATGATTGTACTACTGAAATTTCTAGCTGGCCCCTATATTTTACTCTTCAATTTGATGCAAAATTGAGCTTCTGTCTTTTTTTTTAAAAAAAAAAGTAGAT[T/C]
CCCTATAAGGGAAAACCTCACAACTCAGCAAAACATCCCATTACTGCTGCGCCTAAGGGTGACATATGAGAACCTCAGTTAATGTGACTATGCCACCATC

Reverse complement sequence

GATGGTGGCATAGTCACATTAACTGAGGTTCTCATATGTCACCCTTAGGCGCAGCAGTAATGGGATGTTTTGCTGAGTTGTGAGGTTTTCCCTTATAGGG[A/G]
ATCTACTTTTTTTTTTAAAAAAAAAGACAGAAGCTCAATTTTGCATCAAATTGAAGAGTAAAATATAGGGGCCAGCTAGAAATTTCAGTAGTACAATCAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.00%	22.80%	0.13%	0.00%	NA
All Indica	2759	66.00%	33.80%	0.18%	0.00%	NA
All Japonica	1512	92.00%	8.00%	0.00%	0.00%	NA
Aus	269	98.10%	1.90%	0.00%	0.00%	NA
Indica I	595	77.80%	22.00%	0.17%	0.00%	NA
Indica II	465	44.10%	55.30%	0.65%	0.00%	NA
Indica III	913	71.60%	28.40%	0.00%	0.00%	NA
Indica Intermediate	786	63.50%	36.40%	0.13%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	82.90%	17.10%	0.00%	0.00%	NA
Japonica Intermediate	241	85.90%	14.10%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	78.90%	20.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1108783862	T -> C	LOC_Os11g15500.1	downstream_gene_variant ; 747.0bp to feature; MODIFIER	silent_mutation	Average:46.64; most accessible tissue: Zhenshan97 flower, score: 70.756	N	N	N	N
vg1108783862	T -> C	LOC_Os11g15510.1	downstream_gene_variant ; 235.0bp to feature; MODIFIER	silent_mutation	Average:46.64; most accessible tissue: Zhenshan97 flower, score: 70.756	N	N	N	N
vg1108783862	T -> C	LOC_Os11g15500-LOC_Os11g15510	intergenic_region ; MODIFIER	silent_mutation	Average:46.64; most accessible tissue: Zhenshan97 flower, score: 70.756	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1108783862	NA	2.34E-06	mr1121	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108783862	2.99E-06	2.93E-08	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108783862	4.38E-07	2.07E-11	mr1136	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108783862	1.84E-07	2.68E-10	mr1188	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108783862	8.51E-06	2.18E-08	mr1448	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108783862	NA	1.19E-09	mr1125_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108783862	7.73E-08	5.88E-14	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108783862	NA	9.85E-07	mr1217_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108783862	NA	8.36E-06	mr1218_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251