| Variant ID: vg1108751000 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 8751000 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGTCATCACTGACCACTTAACTCTAACCAAGGCTGAGCCTGTCAAAGGTGAGGGTTTAGATCTGTTTACACCCAAATTTGGCACTTAGGGATAAAATAGG[G/A]
AAAATTTCCAAAGTTTGGAAGTCTGCCGGTTTTCCTCTGTGAGGGCCGGTCTGACCGCCGTGTATAGGCCGGTCAGACCGCCGATAGTGGGCTGGTCAGA
TCTGACCAGCCCACTATCGGCGGTCTGACCGGCCTATACACGGCGGTCAGACCGGCCCTCACAGAGGAAAACCGGCAGACTTCCAAACTTTGGAAATTTT[C/T]
CCTATTTTATCCCTAAGTGCCAAATTTGGGTGTAAACAGATCTAAACCCTCACCTTTGACAGGCTCAGCCTTGGTTAGAGTTAAGTGGTCAGTGATGACT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.50% | 3.30% | 1.93% | 50.28% | NA |
| All Indica | 2759 | 15.40% | 1.70% | 3.15% | 79.67% | NA |
| All Japonica | 1512 | 90.00% | 6.30% | 0.00% | 3.70% | NA |
| Aus | 269 | 68.80% | 1.90% | 1.12% | 28.25% | NA |
| Indica I | 595 | 9.70% | 5.90% | 4.37% | 80.00% | NA |
| Indica II | 465 | 16.60% | 0.00% | 4.73% | 78.71% | NA |
| Indica III | 913 | 13.90% | 0.00% | 2.30% | 83.79% | NA |
| Indica Intermediate | 786 | 20.90% | 1.70% | 2.29% | 75.19% | NA |
| Temperate Japonica | 767 | 98.20% | 0.10% | 0.00% | 1.69% | NA |
| Tropical Japonica | 504 | 80.40% | 16.30% | 0.00% | 3.37% | NA |
| Japonica Intermediate | 241 | 84.20% | 5.00% | 0.00% | 10.79% | NA |
| VI/Aromatic | 96 | 92.70% | 0.00% | 0.00% | 7.29% | NA |
| Intermediate | 90 | 48.90% | 6.70% | 1.11% | 43.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1108751000 | G -> A | LOC_Os11g15440.1 | upstream_gene_variant ; 1323.0bp to feature; MODIFIER | silent_mutation | Average:45.646; most accessible tissue: Minghui63 young leaf, score: 82.087 | N | N | N | N |
| vg1108751000 | G -> A | LOC_Os11g15430.1 | downstream_gene_variant ; 4637.0bp to feature; MODIFIER | silent_mutation | Average:45.646; most accessible tissue: Minghui63 young leaf, score: 82.087 | N | N | N | N |
| vg1108751000 | G -> A | LOC_Os11g15430-LOC_Os11g15440 | intergenic_region ; MODIFIER | silent_mutation | Average:45.646; most accessible tissue: Minghui63 young leaf, score: 82.087 | N | N | N | N |
| vg1108751000 | G -> DEL | N | N | silent_mutation | Average:45.646; most accessible tissue: Minghui63 young leaf, score: 82.087 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1108751000 | NA | 1.66E-07 | mr1125 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108751000 | NA | 1.01E-10 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108751000 | 2.51E-08 | NA | mr1188 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108751000 | 9.62E-06 | 1.75E-09 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108751000 | NA | 1.78E-07 | mr1448 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108751000 | NA | 1.68E-08 | mr1125_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108751000 | NA | 3.86E-08 | mr1136_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108751000 | NA | 1.98E-12 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108751000 | NA | 2.82E-06 | mr1218_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |