\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1108740309:

Variant ID: vg1108740309 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 8740309
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.76, T: 0.22, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:


GGTTCTATTTACAGGCACGGGAGGGAGAGATCGATTTCACAACTTGCAACGAGAGGAAATCGACGCCAAAAAACTAGGGTTCGGTTTGGAGAGATAAACA[T/C]
GAATCGAGCTCGATTCCGGGTGGGATTCAAAGGGATAAGGTCTGATTCTTGGGACAAACGGAAGAGGATTATAAGGGAAACAAATCCCCAAAACTAATTT

Reverse complement sequence

AAATTAGTTTTGGGGATTTGTTTCCCTTATAATCCTCTTCCGTTTGTCCCAAGAATCAGACCTTATCCCTTTGAATCCCACCCGGAATCGAGCTCGATTC[A/G]
TGTTTATCTCTCCAAACCGAACCCTAGTTTTTTGGCGTCGATTTCCTCTCGTTGCAAGTTGTGAAATCGATCTCTCCCTCCCGTGCCTGTAAATAGAACC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.30% 40.00% 0.42% 17.29% NA
All Indica  2759 64.20% 7.60% 0.69% 27.55% NA
All Japonica  1512 8.30% 89.60% 0.07% 2.12% NA
Aus  269 25.30% 72.10% 0.00% 2.60% NA
Indica I  595 84.90% 7.40% 0.17% 7.56% NA
Indica II  465 44.70% 12.00% 1.29% 41.94% NA
Indica III  913 65.80% 2.00% 0.55% 31.65% NA
Indica Intermediate  786 58.10% 11.60% 0.89% 29.39% NA
Temperate Japonica  767 2.00% 98.00% 0.00% 0.00% NA
Tropical Japonica  504 19.00% 79.20% 0.20% 1.59% NA
Japonica Intermediate  241 5.80% 84.20% 0.00% 9.96% NA
VI/Aromatic  96 0.00% 92.70% 0.00% 7.29% NA
Intermediate  90 40.00% 47.80% 0.00% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1108740309 T -> DEL N N silent_mutation Average:32.96; most accessible tissue: Callus, score: 84.737 N N N N
vg1108740309 T -> C LOC_Os11g15430.1 upstream_gene_variant ; 2157.0bp to feature; MODIFIER silent_mutation Average:32.96; most accessible tissue: Callus, score: 84.737 N N N N
vg1108740309 T -> C LOC_Os11g15420.1 downstream_gene_variant ; 2857.0bp to feature; MODIFIER silent_mutation Average:32.96; most accessible tissue: Callus, score: 84.737 N N N N
vg1108740309 T -> C LOC_Os11g15420-LOC_Os11g15430 intergenic_region ; MODIFIER silent_mutation Average:32.96; most accessible tissue: Callus, score: 84.737 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1108740309 NA 1.71E-08 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108740309 NA 1.31E-10 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108740309 NA 1.92E-06 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108740309 NA 6.57E-10 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108740309 NA 9.26E-20 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108740309 NA 6.38E-22 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108740309 NA 1.19E-14 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108740309 NA 7.94E-07 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108740309 NA 2.84E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108740309 NA 1.69E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108740309 NA 3.01E-11 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108740309 NA 3.27E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108740309 NA 1.52E-25 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108740309 NA 4.13E-23 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108740309 NA 1.38E-34 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108740309 NA 1.27E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108740309 NA 2.10E-08 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108740309 NA 4.58E-20 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108740309 NA 3.90E-25 mr1924_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108740309 NA 1.98E-09 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108740309 NA 2.42E-28 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251