\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1108673107:

Variant ID: vg1108673107 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 8673107
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCTGAAAAATGAACAAAATATTACTTAACATCTTATAAGATAAGTACTACTAAATTAATAAGAAATGATTAGTACCCTTTTACTTACTTTTATGATTTT[C/T]
CGGTTCTTCTTTGGAAAAAAAATACAAAAAATCGCCCCCTTCATGAACAGTGGGAGATAAGTACAGACAACAGACTGGTGGAGTATATATAGTGTGCAAA

Reverse complement sequence

TTTGCACACTATATATACTCCACCAGTCTGTTGTCTGTACTTATCTCCCACTGTTCATGAAGGGGGCGATTTTTTGTATTTTTTTTCCAAAGAAGAACCG[G/A]
AAAATCATAAAAGTAAGTAAAAGGGTACTAATCATTTCTTATTAATTTAGTAGTACTTATCTTATAAGATGTTAAGTAATATTTTGTTCATTTTTCAGCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.40% 3.20% 0.53% 15.83% NA
All Indica  2759 72.40% 1.70% 0.87% 25.05% NA
All Japonica  1512 91.70% 6.20% 0.00% 2.12% NA
Aus  269 95.50% 1.90% 0.00% 2.60% NA
Indica I  595 88.40% 5.50% 0.17% 5.88% NA
Indica II  465 60.20% 0.00% 1.51% 38.28% NA
Indica III  913 68.60% 0.00% 0.55% 30.89% NA
Indica Intermediate  786 72.00% 1.70% 1.40% 24.94% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 82.30% 16.10% 0.00% 1.59% NA
Japonica Intermediate  241 85.10% 5.00% 0.00% 9.96% NA
VI/Aromatic  96 92.70% 0.00% 0.00% 7.29% NA
Intermediate  90 80.00% 6.70% 1.11% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1108673107 C -> T LOC_Os11g15320.1 upstream_gene_variant ; 3340.0bp to feature; MODIFIER silent_mutation Average:37.014; most accessible tissue: Zhenshan97 root, score: 82.549 N N N N
vg1108673107 C -> T LOC_Os11g15340.2 upstream_gene_variant ; 4207.0bp to feature; MODIFIER silent_mutation Average:37.014; most accessible tissue: Zhenshan97 root, score: 82.549 N N N N
vg1108673107 C -> T LOC_Os11g15320-LOC_Os11g15340 intergenic_region ; MODIFIER silent_mutation Average:37.014; most accessible tissue: Zhenshan97 root, score: 82.549 N N N N
vg1108673107 C -> DEL N N silent_mutation Average:37.014; most accessible tissue: Zhenshan97 root, score: 82.549 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1108673107 C T -0.03 0.0 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1108673107 NA 2.25E-06 mr1027 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108673107 NA 2.07E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108673107 NA 5.03E-07 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108673107 NA 3.57E-10 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108673107 8.54E-09 5.35E-14 mr1188 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108673107 NA 8.76E-06 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108673107 NA 3.05E-09 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108673107 NA 1.38E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108673107 1.30E-07 2.39E-16 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108673107 NA 7.63E-07 mr1218_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108673107 7.12E-06 7.11E-06 mr1333_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251