Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1108671668:

Variant ID: vg1108671668 (JBrowse)	Variation Type: INDEL
Chromosome: chr11	Position: 8671668
Reference Allele: TG	Alternative Allele: CG,T
Primary Allele: TG	Secondary Allele: CG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTGGGACGAGGCTCATATGTTGGGCAGTCGCGGAGTGCGGGTAAAGTGTACATCCACTGCAGTGTGAGTAAACGAAATCTATTCGAATAGCCGTGCTCG[TG/CG,T]
GTTATTGAGCACCGGGACATGTATTACACTTGGCTAGACTCTAAATTCTTAACTTGTGTGGGATGGGATATTGCATGATGATTTCTATGCTGATGAAGCC

Reverse complement sequence

GGCTTCATCAGCATAGAAATCATCATGCAATATCCCATCCCACACAAGTTAAGAATTTAGAGTCTAGCCAAGTGTAATACATGTCCCGGTGCTCAATAAC[CA/CG,A]
CGAGCACGGCTATTCGAATAGATTTCGTTTACTCACACTGCAGTGGATGTACACTTTACCCGCACTCCGCGACTGCCCAACATATGAGCCTCGTCCCAAC

Allele Frequencies:

Populations	Population Size	Frequency of TG(primary allele)	Frequency of CG(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.60%	27.40%	9.92%	7.09%	T: 0.02%
All Indica	2759	29.30%	43.10%	15.84%	11.78%	NA
All Japonica	1512	97.90%	1.30%	0.60%	0.13%	T: 0.07%
Aus	269	70.60%	24.20%	5.20%	0.00%	NA
Indica I	595	19.80%	54.10%	18.49%	7.56%	NA
Indica II	465	24.90%	33.10%	17.85%	24.09%	NA
Indica III	913	34.10%	43.90%	12.81%	9.20%	NA
Indica Intermediate	786	33.50%	39.70%	16.16%	10.69%	NA
Temperate Japonica	767	98.20%	1.60%	0.26%	0.00%	NA
Tropical Japonica	504	98.00%	1.20%	0.60%	0.00%	T: 0.20%
Japonica Intermediate	241	97.10%	0.40%	1.66%	0.83%	NA
VI/Aromatic	96	96.90%	0.00%	1.04%	2.08%	NA
Intermediate	90	61.10%	23.30%	8.89%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1108671668	TG -> T	LOC_Os11g15320.1	upstream_gene_variant ; 1902.0bp to feature; MODIFIER	silent_mutation	Average:22.211; most accessible tissue: Zhenshan97 flag leaf, score: 39.979	N	N	N	N
vg1108671668	TG -> T	LOC_Os11g15320-LOC_Os11g15340	intergenic_region ; MODIFIER	silent_mutation	Average:22.211; most accessible tissue: Zhenshan97 flag leaf, score: 39.979	N	N	N	N
vg1108671668	TG -> DEL	N	N	silent_mutation	Average:22.211; most accessible tissue: Zhenshan97 flag leaf, score: 39.979	N	N	N	N
vg1108671668	TG -> CG	LOC_Os11g15320.1	upstream_gene_variant ; 1901.0bp to feature; MODIFIER	silent_mutation	Average:22.211; most accessible tissue: Zhenshan97 flag leaf, score: 39.979	N	N	N	N
vg1108671668	TG -> CG	LOC_Os11g15320-LOC_Os11g15340	intergenic_region ; MODIFIER	silent_mutation	Average:22.211; most accessible tissue: Zhenshan97 flag leaf, score: 39.979	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1108671668	7.60E-07	NA	mr1138	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251