\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1108670109:

Variant ID: vg1108670109 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 8670109
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, C: 0.09, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


GAGCCGGGAGAGAGAAAAGAGGGAAGAGAGAAAGAAAAGGAAAAAGAAAAGAAAGGAGAGAAAAAGAAAAGAAAGAAAAATAGAAATTAGGGGGAGATTA[C/G]
GGAAGTTTAGAAAATTTAAAATAATTAGAATTTAATTATAGATTAATTATAGTCGTAGAATTGCAAAATTTAATATAAATTATGGATTATTCTTGGTAAT

Reverse complement sequence

ATTACCAAGAATAATCCATAATTTATATTAAATTTTGCAATTCTACGACTATAATTAATCTATAATTAAATTCTAATTATTTTAAATTTTCTAAACTTCC[G/C]
TAATCTCCCCCTAATTTCTATTTTTCTTTCTTTTCTTTTTCTCTCCTTTCTTTTCTTTTTCCTTTTCTTTCTCTCTTCCCTCTTTTCTCTCTCCCGGCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.30% 5.10% 21.10% 37.49% NA
All Indica  2759 2.20% 6.90% 30.41% 60.46% NA
All Japonica  1512 88.90% 0.90% 6.68% 3.57% NA
Aus  269 66.90% 13.40% 13.01% 6.69% NA
Indica I  595 1.00% 2.70% 26.72% 69.58% NA
Indica II  465 1.10% 4.30% 22.15% 72.47% NA
Indica III  913 1.00% 11.20% 40.31% 47.54% NA
Indica Intermediate  786 5.30% 6.60% 26.59% 61.45% NA
Temperate Japonica  767 96.60% 0.00% 1.69% 1.69% NA
Tropical Japonica  504 79.20% 2.20% 15.28% 3.37% NA
Japonica Intermediate  241 84.60% 0.80% 4.56% 9.96% NA
VI/Aromatic  96 94.80% 0.00% 0.00% 5.21% NA
Intermediate  90 41.10% 4.40% 24.44% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1108670109 C -> DEL N N silent_mutation Average:11.129; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg1108670109 C -> G LOC_Os11g15320.1 upstream_gene_variant ; 342.0bp to feature; MODIFIER silent_mutation Average:11.129; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg1108670109 C -> G LOC_Os11g15320-LOC_Os11g15340 intergenic_region ; MODIFIER silent_mutation Average:11.129; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1108670109 NA 8.55E-10 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108670109 NA 8.06E-12 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108670109 NA 2.57E-07 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108670109 NA 4.31E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108670109 NA 2.78E-13 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108670109 NA 2.33E-08 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108670109 NA 2.86E-11 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108670109 NA 3.02E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108670109 NA 3.41E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108670109 NA 4.51E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108670109 NA 4.84E-11 mr1986_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251