\
| Variant ID: vg1108670109 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 8670109 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, C: 0.09, others allele: 0.00, population size: 90. )
GAGCCGGGAGAGAGAAAAGAGGGAAGAGAGAAAGAAAAGGAAAAAGAAAAGAAAGGAGAGAAAAAGAAAAGAAAGAAAAATAGAAATTAGGGGGAGATTA[C/G]
GGAAGTTTAGAAAATTTAAAATAATTAGAATTTAATTATAGATTAATTATAGTCGTAGAATTGCAAAATTTAATATAAATTATGGATTATTCTTGGTAAT
ATTACCAAGAATAATCCATAATTTATATTAAATTTTGCAATTCTACGACTATAATTAATCTATAATTAAATTCTAATTATTTTAAATTTTCTAAACTTCC[G/C]
TAATCTCCCCCTAATTTCTATTTTTCTTTCTTTTCTTTTTCTCTCCTTTCTTTTCTTTTTCCTTTTCTTTCTCTCTTCCCTCTTTTCTCTCTCCCGGCTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.30% | 5.10% | 21.10% | 37.49% | NA |
| All Indica | 2759 | 2.20% | 6.90% | 30.41% | 60.46% | NA |
| All Japonica | 1512 | 88.90% | 0.90% | 6.68% | 3.57% | NA |
| Aus | 269 | 66.90% | 13.40% | 13.01% | 6.69% | NA |
| Indica I | 595 | 1.00% | 2.70% | 26.72% | 69.58% | NA |
| Indica II | 465 | 1.10% | 4.30% | 22.15% | 72.47% | NA |
| Indica III | 913 | 1.00% | 11.20% | 40.31% | 47.54% | NA |
| Indica Intermediate | 786 | 5.30% | 6.60% | 26.59% | 61.45% | NA |
| Temperate Japonica | 767 | 96.60% | 0.00% | 1.69% | 1.69% | NA |
| Tropical Japonica | 504 | 79.20% | 2.20% | 15.28% | 3.37% | NA |
| Japonica Intermediate | 241 | 84.60% | 0.80% | 4.56% | 9.96% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 0.00% | 5.21% | NA |
| Intermediate | 90 | 41.10% | 4.40% | 24.44% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1108670109 | C -> DEL | N | N | silent_mutation | Average:11.129; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
| vg1108670109 | C -> G | LOC_Os11g15320.1 | upstream_gene_variant ; 342.0bp to feature; MODIFIER | silent_mutation | Average:11.129; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
| vg1108670109 | C -> G | LOC_Os11g15320-LOC_Os11g15340 | intergenic_region ; MODIFIER | silent_mutation | Average:11.129; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1108670109 | NA | 8.55E-10 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108670109 | NA | 8.06E-12 | mr1188 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108670109 | NA | 2.57E-07 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108670109 | NA | 4.31E-08 | mr1136_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108670109 | NA | 2.78E-13 | mr1188_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108670109 | NA | 2.33E-08 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108670109 | NA | 2.86E-11 | mr1228_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108670109 | NA | 3.02E-09 | mr1835_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108670109 | NA | 3.41E-21 | mr1924_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108670109 | NA | 4.51E-08 | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108670109 | NA | 4.84E-11 | mr1986_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |