\
| Variant ID: vg1108660993 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 8660993 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGTCACGAAATCCACAAGATTAGATTAAACAGTGAAACCTTTGTTGTCATCGGTTAAATCCAATTTATATGTATATGCAATCCTTATGAGCCGATGCAAC[G/A]
TCCAGATAACTCACCGGCTGAAACCCCGATGAAACCCTTATTGGCAATCAAGAAGCAGGCTAGAGATTATGGTTCTAAGGACGACTTAGTAGATCAAACT
AGTTTGATCTACTAAGTCGTCCTTAGAACCATAATCTCTAGCCTGCTTCTTGATTGCCAATAAGGGTTTCATCGGGGTTTCAGCCGGTGAGTTATCTGGA[C/T]
GTTGCATCGGCTCATAAGGATTGCATATACATATAAATTGGATTTAACCGATGACAACAAAGGTTTCACTGTTTAATCTAATCTTGTGGATTTCGTGACA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.40% | 3.30% | 4.27% | 6.94% | NA |
| All Indica | 2759 | 80.20% | 1.80% | 7.03% | 10.95% | NA |
| All Japonica | 1512 | 92.30% | 6.30% | 0.26% | 1.06% | NA |
| Aus | 269 | 97.00% | 1.90% | 0.74% | 0.37% | NA |
| Indica I | 595 | 85.00% | 5.50% | 3.70% | 5.71% | NA |
| Indica II | 465 | 69.70% | 0.00% | 10.97% | 19.35% | NA |
| Indica III | 913 | 83.40% | 0.20% | 7.34% | 9.09% | NA |
| Indica Intermediate | 786 | 79.00% | 2.00% | 6.87% | 12.09% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 83.10% | 16.30% | 0.20% | 0.40% | NA |
| Japonica Intermediate | 241 | 88.00% | 5.00% | 1.24% | 5.81% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 83.30% | 6.70% | 2.22% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1108660993 | G -> A | LOC_Os11g15310.1 | downstream_gene_variant ; 4591.0bp to feature; MODIFIER | silent_mutation | Average:20.305; most accessible tissue: Zhenshan97 flag leaf, score: 51.466 | N | N | N | N |
| vg1108660993 | G -> A | LOC_Os11g15310-LOC_Os11g15320 | intergenic_region ; MODIFIER | silent_mutation | Average:20.305; most accessible tissue: Zhenshan97 flag leaf, score: 51.466 | N | N | N | N |
| vg1108660993 | G -> DEL | N | N | silent_mutation | Average:20.305; most accessible tissue: Zhenshan97 flag leaf, score: 51.466 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1108660993 | 2.91E-07 | 1.53E-09 | mr1125 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108660993 | NA | 2.40E-10 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108660993 | 1.77E-07 | NA | mr1188 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108660993 | 1.08E-09 | 1.18E-13 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108660993 | 2.48E-06 | 5.35E-09 | mr1448 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108660993 | NA | 5.14E-06 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108660993 | 5.94E-07 | 1.69E-11 | mr1125_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108660993 | NA | 2.46E-09 | mr1136_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108660993 | 6.89E-08 | 1.03E-16 | mr1188_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108660993 | NA | 3.23E-06 | mr1218_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108660993 | NA | 4.92E-06 | mr1633_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |