\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1108660993:

Variant ID: vg1108660993 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 8660993
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTCACGAAATCCACAAGATTAGATTAAACAGTGAAACCTTTGTTGTCATCGGTTAAATCCAATTTATATGTATATGCAATCCTTATGAGCCGATGCAAC[G/A]
TCCAGATAACTCACCGGCTGAAACCCCGATGAAACCCTTATTGGCAATCAAGAAGCAGGCTAGAGATTATGGTTCTAAGGACGACTTAGTAGATCAAACT

Reverse complement sequence

AGTTTGATCTACTAAGTCGTCCTTAGAACCATAATCTCTAGCCTGCTTCTTGATTGCCAATAAGGGTTTCATCGGGGTTTCAGCCGGTGAGTTATCTGGA[C/T]
GTTGCATCGGCTCATAAGGATTGCATATACATATAAATTGGATTTAACCGATGACAACAAAGGTTTCACTGTTTAATCTAATCTTGTGGATTTCGTGACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.40% 3.30% 4.27% 6.94% NA
All Indica  2759 80.20% 1.80% 7.03% 10.95% NA
All Japonica  1512 92.30% 6.30% 0.26% 1.06% NA
Aus  269 97.00% 1.90% 0.74% 0.37% NA
Indica I  595 85.00% 5.50% 3.70% 5.71% NA
Indica II  465 69.70% 0.00% 10.97% 19.35% NA
Indica III  913 83.40% 0.20% 7.34% 9.09% NA
Indica Intermediate  786 79.00% 2.00% 6.87% 12.09% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 83.10% 16.30% 0.20% 0.40% NA
Japonica Intermediate  241 88.00% 5.00% 1.24% 5.81% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 83.30% 6.70% 2.22% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1108660993 G -> A LOC_Os11g15310.1 downstream_gene_variant ; 4591.0bp to feature; MODIFIER silent_mutation Average:20.305; most accessible tissue: Zhenshan97 flag leaf, score: 51.466 N N N N
vg1108660993 G -> A LOC_Os11g15310-LOC_Os11g15320 intergenic_region ; MODIFIER silent_mutation Average:20.305; most accessible tissue: Zhenshan97 flag leaf, score: 51.466 N N N N
vg1108660993 G -> DEL N N silent_mutation Average:20.305; most accessible tissue: Zhenshan97 flag leaf, score: 51.466 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1108660993 2.91E-07 1.53E-09 mr1125 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108660993 NA 2.40E-10 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108660993 1.77E-07 NA mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108660993 1.08E-09 1.18E-13 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108660993 2.48E-06 5.35E-09 mr1448 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108660993 NA 5.14E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108660993 5.94E-07 1.69E-11 mr1125_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108660993 NA 2.46E-09 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108660993 6.89E-08 1.03E-16 mr1188_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108660993 NA 3.23E-06 mr1218_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108660993 NA 4.92E-06 mr1633_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251