Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1108626672:

Variant ID: vg1108626672 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 8626672
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

GTGTCTCCAAAAAATATGTGTTCCATCGAACAATACCGCATACTCGATAAGGACCCTCCCAACTAGGAGACCACTTACCGAACTCCCTGGATCGAGTACC[C/T]
AAAGGCAAAATTGTCTTCCAAACCAAGTCTCCAACTTGAAACAACTTTGCTCTCACCCTTTTGTTGTACGACTTGGCCACCCTCTTCTTCTCTTTCTCTA

Reverse complement sequence

TAGAGAAAGAGAAGAAGAGGGTGGCCAAGTCGTACAACAAAAGGGTGAGAGCAAAGTTGTTTCAAGTTGGAGACTTGGTTTGGAAGACAATTTTGCCTTT[G/A]
GGTACTCGATCCAGGGAGTTCGGTAAGTGGTCTCCTAGTTGGGAGGGTCCTTATCGAGTATGCGGTATTGTTCGATGGAACACATATTTTTTGGAGACAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.20%	7.70%	3.26%	10.90%	NA
All Indica	2759	68.30%	9.00%	5.55%	17.22%	NA
All Japonica	1512	91.50%	6.70%	0.00%	1.79%	NA
Aus	269	95.90%	1.90%	0.00%	2.23%	NA
Indica I	595	77.10%	13.40%	2.35%	7.06%	NA
Indica II	465	64.30%	1.30%	6.45%	27.96%	NA
Indica III	913	64.10%	11.60%	7.12%	17.20%	NA
Indica Intermediate	786	68.80%	7.00%	5.60%	18.58%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	81.50%	17.30%	0.00%	1.19%	NA
Japonica Intermediate	241	86.30%	5.00%	0.00%	8.71%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	82.20%	11.10%	1.11%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1108626672	C -> T	LOC_Os11g15260.1	downstream_gene_variant ; 4805.0bp to feature; MODIFIER	silent_mutation	Average:19.542; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N
vg1108626672	C -> T	LOC_Os11g15280.1	downstream_gene_variant ; 4957.0bp to feature; MODIFIER	silent_mutation	Average:19.542; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N
vg1108626672	C -> T	LOC_Os11g15260-LOC_Os11g15280	intergenic_region ; MODIFIER	silent_mutation	Average:19.542; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N
vg1108626672	C -> DEL	N	N	silent_mutation	Average:19.542; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1108626672	NA	5.10E-07	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108626672	1.95E-06	1.23E-10	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108626672	3.21E-11	3.00E-13	mr1188	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108626672	NA	4.99E-07	mr1448	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108626672	NA	1.38E-08	mr1125_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108626672	1.80E-09	1.52E-15	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251