\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1108626672:

Variant ID: vg1108626672 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 8626672
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


GTGTCTCCAAAAAATATGTGTTCCATCGAACAATACCGCATACTCGATAAGGACCCTCCCAACTAGGAGACCACTTACCGAACTCCCTGGATCGAGTACC[C/T]
AAAGGCAAAATTGTCTTCCAAACCAAGTCTCCAACTTGAAACAACTTTGCTCTCACCCTTTTGTTGTACGACTTGGCCACCCTCTTCTTCTCTTTCTCTA

Reverse complement sequence

TAGAGAAAGAGAAGAAGAGGGTGGCCAAGTCGTACAACAAAAGGGTGAGAGCAAAGTTGTTTCAAGTTGGAGACTTGGTTTGGAAGACAATTTTGCCTTT[G/A]
GGTACTCGATCCAGGGAGTTCGGTAAGTGGTCTCCTAGTTGGGAGGGTCCTTATCGAGTATGCGGTATTGTTCGATGGAACACATATTTTTTGGAGACAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.20% 7.70% 3.26% 10.90% NA
All Indica  2759 68.30% 9.00% 5.55% 17.22% NA
All Japonica  1512 91.50% 6.70% 0.00% 1.79% NA
Aus  269 95.90% 1.90% 0.00% 2.23% NA
Indica I  595 77.10% 13.40% 2.35% 7.06% NA
Indica II  465 64.30% 1.30% 6.45% 27.96% NA
Indica III  913 64.10% 11.60% 7.12% 17.20% NA
Indica Intermediate  786 68.80% 7.00% 5.60% 18.58% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 81.50% 17.30% 0.00% 1.19% NA
Japonica Intermediate  241 86.30% 5.00% 0.00% 8.71% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 82.20% 11.10% 1.11% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1108626672 C -> T LOC_Os11g15260.1 downstream_gene_variant ; 4805.0bp to feature; MODIFIER silent_mutation Average:19.542; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 N N N N
vg1108626672 C -> T LOC_Os11g15280.1 downstream_gene_variant ; 4957.0bp to feature; MODIFIER silent_mutation Average:19.542; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 N N N N
vg1108626672 C -> T LOC_Os11g15260-LOC_Os11g15280 intergenic_region ; MODIFIER silent_mutation Average:19.542; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 N N N N
vg1108626672 C -> DEL N N silent_mutation Average:19.542; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1108626672 NA 5.10E-07 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108626672 1.95E-06 1.23E-10 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108626672 3.21E-11 3.00E-13 mr1188 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108626672 NA 4.99E-07 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108626672 NA 1.38E-08 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108626672 1.80E-09 1.52E-15 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251