\
| Variant ID: vg1108626672 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 8626672 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 254. )
GTGTCTCCAAAAAATATGTGTTCCATCGAACAATACCGCATACTCGATAAGGACCCTCCCAACTAGGAGACCACTTACCGAACTCCCTGGATCGAGTACC[C/T]
AAAGGCAAAATTGTCTTCCAAACCAAGTCTCCAACTTGAAACAACTTTGCTCTCACCCTTTTGTTGTACGACTTGGCCACCCTCTTCTTCTCTTTCTCTA
TAGAGAAAGAGAAGAAGAGGGTGGCCAAGTCGTACAACAAAAGGGTGAGAGCAAAGTTGTTTCAAGTTGGAGACTTGGTTTGGAAGACAATTTTGCCTTT[G/A]
GGTACTCGATCCAGGGAGTTCGGTAAGTGGTCTCCTAGTTGGGAGGGTCCTTATCGAGTATGCGGTATTGTTCGATGGAACACATATTTTTTGGAGACAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.20% | 7.70% | 3.26% | 10.90% | NA |
| All Indica | 2759 | 68.30% | 9.00% | 5.55% | 17.22% | NA |
| All Japonica | 1512 | 91.50% | 6.70% | 0.00% | 1.79% | NA |
| Aus | 269 | 95.90% | 1.90% | 0.00% | 2.23% | NA |
| Indica I | 595 | 77.10% | 13.40% | 2.35% | 7.06% | NA |
| Indica II | 465 | 64.30% | 1.30% | 6.45% | 27.96% | NA |
| Indica III | 913 | 64.10% | 11.60% | 7.12% | 17.20% | NA |
| Indica Intermediate | 786 | 68.80% | 7.00% | 5.60% | 18.58% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 81.50% | 17.30% | 0.00% | 1.19% | NA |
| Japonica Intermediate | 241 | 86.30% | 5.00% | 0.00% | 8.71% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 82.20% | 11.10% | 1.11% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1108626672 | C -> T | LOC_Os11g15260.1 | downstream_gene_variant ; 4805.0bp to feature; MODIFIER | silent_mutation | Average:19.542; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 | N | N | N | N |
| vg1108626672 | C -> T | LOC_Os11g15280.1 | downstream_gene_variant ; 4957.0bp to feature; MODIFIER | silent_mutation | Average:19.542; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 | N | N | N | N |
| vg1108626672 | C -> T | LOC_Os11g15260-LOC_Os11g15280 | intergenic_region ; MODIFIER | silent_mutation | Average:19.542; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 | N | N | N | N |
| vg1108626672 | C -> DEL | N | N | silent_mutation | Average:19.542; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1108626672 | NA | 5.10E-07 | mr1125 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108626672 | 1.95E-06 | 1.23E-10 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108626672 | 3.21E-11 | 3.00E-13 | mr1188 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108626672 | NA | 4.99E-07 | mr1448 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108626672 | NA | 1.38E-08 | mr1125_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108626672 | 1.80E-09 | 1.52E-15 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |