Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1108623696:

Variant ID: vg1108623696 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 8623696
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGTGGATACCGGTAGAGGCGCCACTGGTTTGCGGTGCTGATCGGCGTGGGAATACGGCGAGGAGAACGCACGAGGAGGAGAAGGTCGAGACGGTGCGATT[A/G]
ACTACTTCCTCTACATCGACGCGCGCTACTTCGCGAGAATTCCTTCGACTTCTTAGCGCCTTCTTCCGCTGCGCAGTGCGTTGAGTGGTAATGATCTACG

Reverse complement sequence

CGTAGATCATTACCACTCAACGCACTGCGCAGCGGAAGAAGGCGCTAAGAAGTCGAAGGAATTCTCGCGAAGTAGCGCGCGTCGATGTAGAGGAAGTAGT[T/C]
AATCGCACCGTCTCGACCTTCTCCTCCTCGTGCGTTCTCCTCGCCGTATTCCCACGCCGATCAGCACCGCAAACCAGTGGCGCCTCTACCGGTATCCACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.00%	8.60%	2.58%	19.81%	NA
All Indica	2759	66.10%	0.50%	1.38%	31.97%	NA
All Japonica	1512	68.30%	24.90%	4.70%	2.05%	NA
Aus	269	95.50%	0.70%	0.74%	2.97%	NA
Indica I	595	86.40%	0.00%	1.51%	12.10%	NA
Indica II	465	45.40%	0.90%	0.86%	52.90%	NA
Indica III	913	66.20%	0.90%	0.22%	32.75%	NA
Indica Intermediate	786	63.00%	0.40%	2.93%	33.72%	NA
Temperate Japonica	767	49.00%	44.30%	6.65%	0.00%	NA
Tropical Japonica	504	94.40%	1.80%	2.58%	1.19%	NA
Japonica Intermediate	241	75.10%	11.60%	2.90%	10.37%	NA
VI/Aromatic	96	92.70%	0.00%	5.21%	2.08%	NA
Intermediate	90	66.70%	12.20%	6.67%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1108623696	A -> DEL	N	N	silent_mutation	Average:26.278; most accessible tissue: Zhenshan97 flag leaf, score: 63.67	N	N	N	N
vg1108623696	A -> G	LOC_Os11g15260.1	downstream_gene_variant ; 1829.0bp to feature; MODIFIER	silent_mutation	Average:26.278; most accessible tissue: Zhenshan97 flag leaf, score: 63.67	N	N	N	N
vg1108623696	A -> G	LOC_Os11g15260-LOC_Os11g15280	intergenic_region ; MODIFIER	silent_mutation	Average:26.278; most accessible tissue: Zhenshan97 flag leaf, score: 63.67	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1108623696	NA	5.64E-08	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108623696	NA	1.21E-06	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108623696	NA	1.16E-06	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108623696	NA	1.63E-06	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108623696	NA	1.85E-06	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108623696	4.38E-06	4.38E-06	mr1804	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108623696	NA	4.98E-06	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108623696	NA	1.40E-07	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251