\
| Variant ID: vg1108623696 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 8623696 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGTGGATACCGGTAGAGGCGCCACTGGTTTGCGGTGCTGATCGGCGTGGGAATACGGCGAGGAGAACGCACGAGGAGGAGAAGGTCGAGACGGTGCGATT[A/G]
ACTACTTCCTCTACATCGACGCGCGCTACTTCGCGAGAATTCCTTCGACTTCTTAGCGCCTTCTTCCGCTGCGCAGTGCGTTGAGTGGTAATGATCTACG
CGTAGATCATTACCACTCAACGCACTGCGCAGCGGAAGAAGGCGCTAAGAAGTCGAAGGAATTCTCGCGAAGTAGCGCGCGTCGATGTAGAGGAAGTAGT[T/C]
AATCGCACCGTCTCGACCTTCTCCTCCTCGTGCGTTCTCCTCGCCGTATTCCCACGCCGATCAGCACCGCAAACCAGTGGCGCCTCTACCGGTATCCACA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.00% | 8.60% | 2.58% | 19.81% | NA |
| All Indica | 2759 | 66.10% | 0.50% | 1.38% | 31.97% | NA |
| All Japonica | 1512 | 68.30% | 24.90% | 4.70% | 2.05% | NA |
| Aus | 269 | 95.50% | 0.70% | 0.74% | 2.97% | NA |
| Indica I | 595 | 86.40% | 0.00% | 1.51% | 12.10% | NA |
| Indica II | 465 | 45.40% | 0.90% | 0.86% | 52.90% | NA |
| Indica III | 913 | 66.20% | 0.90% | 0.22% | 32.75% | NA |
| Indica Intermediate | 786 | 63.00% | 0.40% | 2.93% | 33.72% | NA |
| Temperate Japonica | 767 | 49.00% | 44.30% | 6.65% | 0.00% | NA |
| Tropical Japonica | 504 | 94.40% | 1.80% | 2.58% | 1.19% | NA |
| Japonica Intermediate | 241 | 75.10% | 11.60% | 2.90% | 10.37% | NA |
| VI/Aromatic | 96 | 92.70% | 0.00% | 5.21% | 2.08% | NA |
| Intermediate | 90 | 66.70% | 12.20% | 6.67% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1108623696 | A -> DEL | N | N | silent_mutation | Average:26.278; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 | N | N | N | N |
| vg1108623696 | A -> G | LOC_Os11g15260.1 | downstream_gene_variant ; 1829.0bp to feature; MODIFIER | silent_mutation | Average:26.278; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 | N | N | N | N |
| vg1108623696 | A -> G | LOC_Os11g15260-LOC_Os11g15280 | intergenic_region ; MODIFIER | silent_mutation | Average:26.278; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1108623696 | NA | 5.64E-08 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108623696 | NA | 1.21E-06 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108623696 | NA | 1.16E-06 | mr1202 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108623696 | NA | 1.63E-06 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108623696 | NA | 1.85E-06 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108623696 | 4.38E-06 | 4.38E-06 | mr1804 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108623696 | NA | 4.98E-06 | mr1627_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108623696 | NA | 1.40E-07 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |