\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1108623696:

Variant ID: vg1108623696 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 8623696
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTGGATACCGGTAGAGGCGCCACTGGTTTGCGGTGCTGATCGGCGTGGGAATACGGCGAGGAGAACGCACGAGGAGGAGAAGGTCGAGACGGTGCGATT[A/G]
ACTACTTCCTCTACATCGACGCGCGCTACTTCGCGAGAATTCCTTCGACTTCTTAGCGCCTTCTTCCGCTGCGCAGTGCGTTGAGTGGTAATGATCTACG

Reverse complement sequence

CGTAGATCATTACCACTCAACGCACTGCGCAGCGGAAGAAGGCGCTAAGAAGTCGAAGGAATTCTCGCGAAGTAGCGCGCGTCGATGTAGAGGAAGTAGT[T/C]
AATCGCACCGTCTCGACCTTCTCCTCCTCGTGCGTTCTCCTCGCCGTATTCCCACGCCGATCAGCACCGCAAACCAGTGGCGCCTCTACCGGTATCCACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.00% 8.60% 2.58% 19.81% NA
All Indica  2759 66.10% 0.50% 1.38% 31.97% NA
All Japonica  1512 68.30% 24.90% 4.70% 2.05% NA
Aus  269 95.50% 0.70% 0.74% 2.97% NA
Indica I  595 86.40% 0.00% 1.51% 12.10% NA
Indica II  465 45.40% 0.90% 0.86% 52.90% NA
Indica III  913 66.20% 0.90% 0.22% 32.75% NA
Indica Intermediate  786 63.00% 0.40% 2.93% 33.72% NA
Temperate Japonica  767 49.00% 44.30% 6.65% 0.00% NA
Tropical Japonica  504 94.40% 1.80% 2.58% 1.19% NA
Japonica Intermediate  241 75.10% 11.60% 2.90% 10.37% NA
VI/Aromatic  96 92.70% 0.00% 5.21% 2.08% NA
Intermediate  90 66.70% 12.20% 6.67% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1108623696 A -> DEL N N silent_mutation Average:26.278; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N
vg1108623696 A -> G LOC_Os11g15260.1 downstream_gene_variant ; 1829.0bp to feature; MODIFIER silent_mutation Average:26.278; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N
vg1108623696 A -> G LOC_Os11g15260-LOC_Os11g15280 intergenic_region ; MODIFIER silent_mutation Average:26.278; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1108623696 NA 5.64E-08 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108623696 NA 1.21E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108623696 NA 1.16E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108623696 NA 1.63E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108623696 NA 1.85E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108623696 4.38E-06 4.38E-06 mr1804 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108623696 NA 4.98E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108623696 NA 1.40E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251