\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1108600295:

Variant ID: vg1108600295 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 8600295
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTGATTCATTGTTAAATATACTTATATGTATACATATAATTTTACATATTTCACAAAAGTTTTTGAATAAGACAAACGGCTAAATATGTGCTAAAAAGT[C/T]
AACGGTGTCAAATATTTAGAAAACGGAGGGAGTATATGACACCAGTTTGCTGCCAAACTAGCTACCCGCGCCGGCGCCGTGCCTCGAATCAAACCTCACG

Reverse complement sequence

CGTGAGGTTTGATTCGAGGCACGGCGCCGGCGCGGGTAGCTAGTTTGGCAGCAAACTGGTGTCATATACTCCCTCCGTTTTCTAAATATTTGACACCGTT[G/A]
ACTTTTTAGCACATATTTAGCCGTTTGTCTTATTCAAAAACTTTTGTGAAATATGTAAAATTATATGTATACATATAAGTATATTTAACAATGAATCAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.90% 3.80% 0.28% 0.00% NA
All Indica  2759 99.50% 0.50% 0.04% 0.00% NA
All Japonica  1512 99.60% 0.30% 0.07% 0.00% NA
Aus  269 43.10% 53.50% 3.35% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 98.60% 1.30% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 1.70% 0.41% 0.00% NA
VI/Aromatic  96 82.30% 16.70% 1.04% 0.00% NA
Intermediate  90 96.70% 2.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1108600295 C -> T LOC_Os11g15230.1 upstream_gene_variant ; 1322.0bp to feature; MODIFIER silent_mutation Average:64.262; most accessible tissue: Callus, score: 87.534 N N N N
vg1108600295 C -> T LOC_Os11g15240.1 upstream_gene_variant ; 2582.0bp to feature; MODIFIER silent_mutation Average:64.262; most accessible tissue: Callus, score: 87.534 N N N N
vg1108600295 C -> T LOC_Os11g15230-LOC_Os11g15240 intergenic_region ; MODIFIER silent_mutation Average:64.262; most accessible tissue: Callus, score: 87.534 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1108600295 1.34E-06 6.26E-19 mr1113 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108600295 2.24E-07 1.40E-21 mr1114 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108600295 2.81E-08 3.21E-18 mr1116 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108600295 6.57E-07 5.08E-21 mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108600295 1.20E-07 1.08E-20 mr1119 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108600295 3.70E-06 1.50E-22 mr1247 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108600295 NA 7.62E-07 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108600295 NA 1.39E-08 mr1348 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108600295 NA 1.20E-06 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108600295 NA 1.61E-14 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108600295 NA 2.85E-07 mr1669 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108600295 NA 4.63E-20 mr1961 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108600295 NA 5.58E-17 mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108600295 7.79E-06 8.78E-19 mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108600295 2.09E-06 2.29E-18 mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108600295 9.51E-07 1.25E-22 mr1120_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108600295 NA 2.77E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108600295 NA 5.69E-18 mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108600295 NA 4.12E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108600295 NA 5.80E-15 mr1961_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251