\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1108350824:

Variant ID: vg1108350824 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 8350824
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:


GGAGCCATGGCGAAGGGTGTCTGCAGTGGCGAACAAAGAGAGCGAGCAAAAGGTCTGAAGGGCAAAGGGGCGCCGTGAAAGGAAGAACAGAGGAAGGAAA[C/T]
GCGCGCTGTGAAAATGACAAGTGTGGCGATGAAAAGAGAACGGGGGGGAAGAATATATAGCCCACCTAGGCGACGGCTCGCCTACCCACCAATTGCAAAG

Reverse complement sequence

CTTTGCAATTGGTGGGTAGGCGAGCCGTCGCCTAGGTGGGCTATATATTCTTCCCCCCCGTTCTCTTTTCATCGCCACACTTGTCATTTTCACAGCGCGC[G/A]
TTTCCTTCCTCTGTTCTTCCTTTCACGGCGCCCCTTTGCCCTTCAGACCTTTTGCTCGCTCTCTTTGTTCGCCACTGCAGACACCCTTCGCCATGGCTCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.70% 40.80% 8.48% 2.03% NA
All Indica  2759 77.50% 7.50% 14.03% 0.94% NA
All Japonica  1512 3.80% 91.30% 0.40% 4.56% NA
Aus  269 24.20% 74.70% 1.12% 0.00% NA
Indica I  595 80.00% 12.60% 7.06% 0.34% NA
Indica II  465 62.40% 3.90% 31.83% 1.94% NA
Indica III  913 89.40% 2.50% 7.56% 0.55% NA
Indica Intermediate  786 70.90% 11.60% 16.28% 1.27% NA
Temperate Japonica  767 1.80% 98.00% 0.13% 0.00% NA
Tropical Japonica  504 4.00% 83.30% 0.99% 11.71% NA
Japonica Intermediate  241 9.50% 86.30% 0.00% 4.15% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 43.30% 50.00% 5.56% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1108350824 C -> T LOC_Os11g14840.1 upstream_gene_variant ; 93.0bp to feature; MODIFIER silent_mutation Average:22.103; most accessible tissue: Zhenshan97 flag leaf, score: 36.135 N N N N
vg1108350824 C -> T LOC_Os11g14830.1 downstream_gene_variant ; 4068.0bp to feature; MODIFIER silent_mutation Average:22.103; most accessible tissue: Zhenshan97 flag leaf, score: 36.135 N N N N
vg1108350824 C -> T LOC_Os11g14840-LOC_Os11g14850 intergenic_region ; MODIFIER silent_mutation Average:22.103; most accessible tissue: Zhenshan97 flag leaf, score: 36.135 N N N N
vg1108350824 C -> DEL N N silent_mutation Average:22.103; most accessible tissue: Zhenshan97 flag leaf, score: 36.135 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1108350824 NA 2.27E-34 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108350824 NA 2.70E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108350824 NA 1.81E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108350824 NA 3.90E-34 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108350824 NA 5.18E-19 mr1199 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108350824 NA 1.01E-16 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108350824 NA 2.79E-12 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108350824 NA 1.94E-11 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108350824 NA 1.15E-28 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108350824 NA 6.17E-12 mr1883 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108350824 NA 1.18E-12 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251