Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1108350824:

Variant ID: vg1108350824 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 8350824
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:

GGAGCCATGGCGAAGGGTGTCTGCAGTGGCGAACAAAGAGAGCGAGCAAAAGGTCTGAAGGGCAAAGGGGCGCCGTGAAAGGAAGAACAGAGGAAGGAAA[C/T]
GCGCGCTGTGAAAATGACAAGTGTGGCGATGAAAAGAGAACGGGGGGGAAGAATATATAGCCCACCTAGGCGACGGCTCGCCTACCCACCAATTGCAAAG

Reverse complement sequence

CTTTGCAATTGGTGGGTAGGCGAGCCGTCGCCTAGGTGGGCTATATATTCTTCCCCCCCGTTCTCTTTTCATCGCCACACTTGTCATTTTCACAGCGCGC[G/A]
TTTCCTTCCTCTGTTCTTCCTTTCACGGCGCCCCTTTGCCCTTCAGACCTTTTGCTCGCTCTCTTTGTTCGCCACTGCAGACACCCTTCGCCATGGCTCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.70%	40.80%	8.48%	2.03%	NA
All Indica	2759	77.50%	7.50%	14.03%	0.94%	NA
All Japonica	1512	3.80%	91.30%	0.40%	4.56%	NA
Aus	269	24.20%	74.70%	1.12%	0.00%	NA
Indica I	595	80.00%	12.60%	7.06%	0.34%	NA
Indica II	465	62.40%	3.90%	31.83%	1.94%	NA
Indica III	913	89.40%	2.50%	7.56%	0.55%	NA
Indica Intermediate	786	70.90%	11.60%	16.28%	1.27%	NA
Temperate Japonica	767	1.80%	98.00%	0.13%	0.00%	NA
Tropical Japonica	504	4.00%	83.30%	0.99%	11.71%	NA
Japonica Intermediate	241	9.50%	86.30%	0.00%	4.15%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	43.30%	50.00%	5.56%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1108350824	C -> T	LOC_Os11g14840.1	upstream_gene_variant ; 93.0bp to feature; MODIFIER	silent_mutation	Average:22.103; most accessible tissue: Zhenshan97 flag leaf, score: 36.135	N	N	N	N
vg1108350824	C -> T	LOC_Os11g14830.1	downstream_gene_variant ; 4068.0bp to feature; MODIFIER	silent_mutation	Average:22.103; most accessible tissue: Zhenshan97 flag leaf, score: 36.135	N	N	N	N
vg1108350824	C -> T	LOC_Os11g14840-LOC_Os11g14850	intergenic_region ; MODIFIER	silent_mutation	Average:22.103; most accessible tissue: Zhenshan97 flag leaf, score: 36.135	N	N	N	N
vg1108350824	C -> DEL	N	N	silent_mutation	Average:22.103; most accessible tissue: Zhenshan97 flag leaf, score: 36.135	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1108350824	NA	2.27E-34	mr1026	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108350824	NA	2.70E-07	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108350824	NA	1.81E-06	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108350824	NA	3.90E-34	mr1161	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108350824	NA	5.18E-19	mr1199	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108350824	NA	1.01E-16	mr1261	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108350824	NA	2.79E-12	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108350824	NA	1.94E-11	mr1657	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108350824	NA	1.15E-28	mr1793	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108350824	NA	6.17E-12	mr1883	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108350824	NA	1.18E-12	mr1514_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251