\
| Variant ID: vg1108350824 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 8350824 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 74. )
GGAGCCATGGCGAAGGGTGTCTGCAGTGGCGAACAAAGAGAGCGAGCAAAAGGTCTGAAGGGCAAAGGGGCGCCGTGAAAGGAAGAACAGAGGAAGGAAA[C/T]
GCGCGCTGTGAAAATGACAAGTGTGGCGATGAAAAGAGAACGGGGGGGAAGAATATATAGCCCACCTAGGCGACGGCTCGCCTACCCACCAATTGCAAAG
CTTTGCAATTGGTGGGTAGGCGAGCCGTCGCCTAGGTGGGCTATATATTCTTCCCCCCCGTTCTCTTTTCATCGCCACACTTGTCATTTTCACAGCGCGC[G/A]
TTTCCTTCCTCTGTTCTTCCTTTCACGGCGCCCCTTTGCCCTTCAGACCTTTTGCTCGCTCTCTTTGTTCGCCACTGCAGACACCCTTCGCCATGGCTCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.70% | 40.80% | 8.48% | 2.03% | NA |
| All Indica | 2759 | 77.50% | 7.50% | 14.03% | 0.94% | NA |
| All Japonica | 1512 | 3.80% | 91.30% | 0.40% | 4.56% | NA |
| Aus | 269 | 24.20% | 74.70% | 1.12% | 0.00% | NA |
| Indica I | 595 | 80.00% | 12.60% | 7.06% | 0.34% | NA |
| Indica II | 465 | 62.40% | 3.90% | 31.83% | 1.94% | NA |
| Indica III | 913 | 89.40% | 2.50% | 7.56% | 0.55% | NA |
| Indica Intermediate | 786 | 70.90% | 11.60% | 16.28% | 1.27% | NA |
| Temperate Japonica | 767 | 1.80% | 98.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 4.00% | 83.30% | 0.99% | 11.71% | NA |
| Japonica Intermediate | 241 | 9.50% | 86.30% | 0.00% | 4.15% | NA |
| VI/Aromatic | 96 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 50.00% | 5.56% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1108350824 | C -> T | LOC_Os11g14840.1 | upstream_gene_variant ; 93.0bp to feature; MODIFIER | silent_mutation | Average:22.103; most accessible tissue: Zhenshan97 flag leaf, score: 36.135 | N | N | N | N |
| vg1108350824 | C -> T | LOC_Os11g14830.1 | downstream_gene_variant ; 4068.0bp to feature; MODIFIER | silent_mutation | Average:22.103; most accessible tissue: Zhenshan97 flag leaf, score: 36.135 | N | N | N | N |
| vg1108350824 | C -> T | LOC_Os11g14840-LOC_Os11g14850 | intergenic_region ; MODIFIER | silent_mutation | Average:22.103; most accessible tissue: Zhenshan97 flag leaf, score: 36.135 | N | N | N | N |
| vg1108350824 | C -> DEL | N | N | silent_mutation | Average:22.103; most accessible tissue: Zhenshan97 flag leaf, score: 36.135 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1108350824 | NA | 2.27E-34 | mr1026 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108350824 | NA | 2.70E-07 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108350824 | NA | 1.81E-06 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108350824 | NA | 3.90E-34 | mr1161 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108350824 | NA | 5.18E-19 | mr1199 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108350824 | NA | 1.01E-16 | mr1261 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108350824 | NA | 2.79E-12 | mr1449 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108350824 | NA | 1.94E-11 | mr1657 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108350824 | NA | 1.15E-28 | mr1793 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108350824 | NA | 6.17E-12 | mr1883 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108350824 | NA | 1.18E-12 | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |