\
| Variant ID: vg1108349674 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 8349674 |
| Reference Allele: G | Alternative Allele: T,C |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.56, G: 0.44, others allele: 0.00, population size: 50. )
ATTCCTTTCGATGAAGGGGGGAGCTGTTCGACTCCACCCCTGGTCTCGTTGTGACCTGGACTTGGTGTAGGAGTGTAGCCAGGGGTGTCGACGCGGTTTT[G/T,C]
GACTGCCTCATCTGCGGCCTTTTCGACCACGGCCTCCGCCTCCTCTTCCTCCTCCCCTTCTTCATCGCCGTCACGCTCTTCGACGTCGTCCTTGTCATTA
TAATGACAAGGACGACGTCGAAGAGCGTGACGGCGATGAAGAAGGGGAGGAGGAAGAGGAGGCGGAGGCCGTGGTCGAAAAGGCCGCAGATGAGGCAGTC[C/A,G]
AAAACCGCGTCGACACCCCTGGCTACACTCCTACACCAAGTCCAGGTCACAACGAGACCAGGGGTGGAGTCGAACAGCTCCCCCCTTCATCGAAAGGAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.00% | 25.00% | 12.55% | 22.18% | C: 0.34% |
| All Indica | 2759 | 7.30% | 41.20% | 17.72% | 33.71% | C: 0.04% |
| All Japonica | 1512 | 90.10% | 1.60% | 1.72% | 6.22% | C: 0.33% |
| Aus | 269 | 72.90% | 1.10% | 23.42% | 2.60% | NA |
| Indica I | 595 | 12.90% | 63.40% | 7.56% | 16.13% | NA |
| Indica II | 465 | 5.20% | 19.60% | 19.14% | 56.13% | NA |
| Indica III | 913 | 1.60% | 43.00% | 21.25% | 34.06% | NA |
| Indica Intermediate | 786 | 10.90% | 35.10% | 20.48% | 33.33% | C: 0.13% |
| Temperate Japonica | 767 | 97.90% | 1.70% | 0.26% | 0.13% | NA |
| Tropical Japonica | 504 | 81.00% | 1.60% | 1.19% | 16.07% | C: 0.20% |
| Japonica Intermediate | 241 | 84.60% | 1.20% | 7.47% | 4.98% | C: 1.66% |
| VI/Aromatic | 96 | 89.60% | 0.00% | 1.04% | 1.04% | C: 8.33% |
| Intermediate | 90 | 46.70% | 17.80% | 15.56% | 17.78% | C: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1108349674 | G -> T | LOC_Os11g14840.1 | missense_variant ; p.Gln327Lys; MODERATE | nonsynonymous_codon ; Q327K | Average:16.848; most accessible tissue: Callus, score: 26.589 | benign |
-1.217 |
TOLERATED | 0.15 |
| vg1108349674 | G -> DEL | LOC_Os11g14840.1 | N | frameshift_variant | Average:16.848; most accessible tissue: Callus, score: 26.589 | N | N | N | N |
| vg1108349674 | G -> C | LOC_Os11g14840.1 | missense_variant ; p.Gln327Glu; MODERATE | nonsynonymous_codon ; Q327E | Average:16.848; most accessible tissue: Callus, score: 26.589 | possibly damaging |
-1.698 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1108349674 | 2.60E-06 | NA | mr1089 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108349674 | 9.11E-06 | NA | mr1093 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108349674 | NA | 4.60E-34 | mr1129 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108349674 | NA | 8.02E-13 | mr1183 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108349674 | NA | 4.13E-19 | mr1255 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108349674 | NA | 1.57E-10 | mr1720 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108349674 | NA | 3.52E-49 | mr1063_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108349674 | NA | 1.09E-16 | mr1180_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108349674 | NA | 1.18E-22 | mr1183_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108349674 | NA | 5.85E-09 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108349674 | NA | 3.19E-11 | mr1228_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108349674 | NA | 2.64E-21 | mr1401_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108349674 | NA | 7.73E-09 | mr1751_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108349674 | NA | 1.22E-07 | mr1885_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108349674 | NA | 1.04E-24 | mr1943_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |