\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1108338451:

Variant ID: vg1108338451 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 8338451
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.90, G: 0.08, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


TTTCTAAAAAATATATATTTATCCAAGCGAAGTCCCACAGTAAATTTCATCTTAACTAAACCATATAATAATAATAATATTAAAATAGACTTCACCCGTT[A/G]
CAACGCATGGGCATTTTTACTAGTATATATTTAATTTCTAAAATTAATTTATCATTTACCCTTATATAGTATATATATGTCCTAACCCAATTCAATTAAA

Reverse complement sequence

TTTAATTGAATTGGGTTAGGACATATATATACTATATAAGGGTAAATGATAAATTAATTTTAGAAATTAAATATATACTAGTAAAAATGCCCATGCGTTG[T/C]
AACGGGTGAAGTCTATTTTAATATTATTATTATTATATGGTTTAGTTAAGATGAAATTTACTGTGGGACTTCGCTTGGATAAATATATATTTTTTAGAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.60% 17.60% 14.68% 27.06% NA
All Indica  2759 7.10% 28.40% 20.33% 44.18% NA
All Japonica  1512 91.90% 0.90% 5.56% 1.72% NA
Aus  269 72.90% 8.20% 14.50% 4.46% NA
Indica I  595 15.10% 17.10% 22.18% 45.55% NA
Indica II  465 3.70% 26.70% 12.04% 57.63% NA
Indica III  913 1.40% 38.40% 24.32% 35.82% NA
Indica Intermediate  786 9.70% 26.20% 19.21% 44.91% NA
Temperate Japonica  767 97.90% 0.10% 0.65% 1.30% NA
Tropical Japonica  504 85.10% 1.60% 11.90% 1.39% NA
Japonica Intermediate  241 86.70% 1.70% 7.88% 3.73% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 50.00% 16.70% 11.11% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1108338451 A -> DEL N N silent_mutation Average:7.692; most accessible tissue: Callus, score: 19.84 N N N N
vg1108338451 A -> G LOC_Os11g14810.1 downstream_gene_variant ; 1111.0bp to feature; MODIFIER silent_mutation Average:7.692; most accessible tissue: Callus, score: 19.84 N N N N
vg1108338451 A -> G LOC_Os11g14820.1 downstream_gene_variant ; 4652.0bp to feature; MODIFIER silent_mutation Average:7.692; most accessible tissue: Callus, score: 19.84 N N N N
vg1108338451 A -> G LOC_Os11g14810-LOC_Os11g14820 intergenic_region ; MODIFIER silent_mutation Average:7.692; most accessible tissue: Callus, score: 19.84 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1108338451 NA 2.38E-57 mr1088 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108338451 NA 3.28E-15 mr1199 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108338451 NA 5.05E-32 mr1224 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108338451 NA 9.45E-62 mr1246 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108338451 NA 4.00E-08 mr1538 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108338451 NA 2.15E-21 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108338451 NA 6.82E-50 mr1063_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108338451 NA 2.45E-11 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108338451 NA 4.31E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108338451 NA 6.64E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108338451 NA 6.62E-23 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108338451 NA 7.35E-06 mr1517_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108338451 NA 4.10E-09 mr1538_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108338451 NA 2.98E-32 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108338451 NA 2.16E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108338451 NA 6.65E-22 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108338451 NA 2.13E-26 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251