Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1108308382:

Variant ID: vg1108308382 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 8308382
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, A: 0.04, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

GAAGAAAAAAAAGAGGAAAATGAAAAAAAGACAAAAAATAGATGTAGGGCTATTATCCACCACGGAGGCCCGAACCAGCATAAAATCTATGTGTCCTCCG[C/A]
CTTCTTTTTATTTATTTGTGTGATTGATAATTTGTGGAAAAACCCCAAGGCTAACGCTTGATCAGCGAAAAAGGCCAGGGGGGCGAAATGAATCGGCCGA

Reverse complement sequence

TCGGCCGATTCATTTCGCCCCCCTGGCCTTTTTCGCTGATCAAGCGTTAGCCTTGGGGTTTTTCCACAAATTATCAATCACACAAATAAATAAAAAGAAG[G/T]
CGGAGGACACATAGATTTTATGCTGGTTCGGGCCTCCGTGGTGGATAATAGCCCTACATCTATTTTTTGTCTTTTTTTCATTTTCCTCTTTTTTTTCTTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.20%	29.90%	1.84%	0.04%	NA
All Indica	2759	50.30%	48.80%	0.91%	0.00%	NA
All Japonica	1512	93.50%	2.30%	4.03%	0.13%	NA
Aus	269	97.80%	1.90%	0.37%	0.00%	NA
Indica I	595	76.80%	22.50%	0.67%	0.00%	NA
Indica II	465	17.80%	81.30%	0.86%	0.00%	NA
Indica III	913	50.20%	49.20%	0.66%	0.00%	NA
Indica Intermediate	786	49.50%	49.10%	1.40%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	86.90%	2.40%	10.52%	0.20%	NA
Japonica Intermediate	241	87.10%	9.10%	3.32%	0.41%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	71.10%	28.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1108308382	C -> A	LOC_Os11g14730.1	upstream_gene_variant ; 4632.0bp to feature; MODIFIER	silent_mutation	Average:24.02; most accessible tissue: Zhenshan97 flag leaf, score: 39.027	N	N	N	N
vg1108308382	C -> A	LOC_Os11g14740.1	downstream_gene_variant ; 162.0bp to feature; MODIFIER	silent_mutation	Average:24.02; most accessible tissue: Zhenshan97 flag leaf, score: 39.027	N	N	N	N
vg1108308382	C -> A	LOC_Os11g14750.1	downstream_gene_variant ; 1176.0bp to feature; MODIFIER	silent_mutation	Average:24.02; most accessible tissue: Zhenshan97 flag leaf, score: 39.027	N	N	N	N
vg1108308382	C -> A	LOC_Os11g14740-LOC_Os11g14750	intergenic_region ; MODIFIER	silent_mutation	Average:24.02; most accessible tissue: Zhenshan97 flag leaf, score: 39.027	N	N	N	N
vg1108308382	C -> DEL	N	N	silent_mutation	Average:24.02; most accessible tissue: Zhenshan97 flag leaf, score: 39.027	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1108308382	NA	8.63E-13	mr1183	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108308382	NA	8.62E-13	mr1503	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108308382	NA	4.52E-30	mr1877	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108308382	NA	1.21E-07	mr1877	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108308382	NA	2.77E-09	mr1929	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251