\
| Variant ID: vg1108308382 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 8308382 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, A: 0.04, others allele: 0.00, population size: 104. )
GAAGAAAAAAAAGAGGAAAATGAAAAAAAGACAAAAAATAGATGTAGGGCTATTATCCACCACGGAGGCCCGAACCAGCATAAAATCTATGTGTCCTCCG[C/A]
CTTCTTTTTATTTATTTGTGTGATTGATAATTTGTGGAAAAACCCCAAGGCTAACGCTTGATCAGCGAAAAAGGCCAGGGGGGCGAAATGAATCGGCCGA
TCGGCCGATTCATTTCGCCCCCCTGGCCTTTTTCGCTGATCAAGCGTTAGCCTTGGGGTTTTTCCACAAATTATCAATCACACAAATAAATAAAAAGAAG[G/T]
CGGAGGACACATAGATTTTATGCTGGTTCGGGCCTCCGTGGTGGATAATAGCCCTACATCTATTTTTTGTCTTTTTTTCATTTTCCTCTTTTTTTTCTTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.20% | 29.90% | 1.84% | 0.04% | NA |
| All Indica | 2759 | 50.30% | 48.80% | 0.91% | 0.00% | NA |
| All Japonica | 1512 | 93.50% | 2.30% | 4.03% | 0.13% | NA |
| Aus | 269 | 97.80% | 1.90% | 0.37% | 0.00% | NA |
| Indica I | 595 | 76.80% | 22.50% | 0.67% | 0.00% | NA |
| Indica II | 465 | 17.80% | 81.30% | 0.86% | 0.00% | NA |
| Indica III | 913 | 50.20% | 49.20% | 0.66% | 0.00% | NA |
| Indica Intermediate | 786 | 49.50% | 49.10% | 1.40% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 86.90% | 2.40% | 10.52% | 0.20% | NA |
| Japonica Intermediate | 241 | 87.10% | 9.10% | 3.32% | 0.41% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 28.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1108308382 | C -> A | LOC_Os11g14730.1 | upstream_gene_variant ; 4632.0bp to feature; MODIFIER | silent_mutation | Average:24.02; most accessible tissue: Zhenshan97 flag leaf, score: 39.027 | N | N | N | N |
| vg1108308382 | C -> A | LOC_Os11g14740.1 | downstream_gene_variant ; 162.0bp to feature; MODIFIER | silent_mutation | Average:24.02; most accessible tissue: Zhenshan97 flag leaf, score: 39.027 | N | N | N | N |
| vg1108308382 | C -> A | LOC_Os11g14750.1 | downstream_gene_variant ; 1176.0bp to feature; MODIFIER | silent_mutation | Average:24.02; most accessible tissue: Zhenshan97 flag leaf, score: 39.027 | N | N | N | N |
| vg1108308382 | C -> A | LOC_Os11g14740-LOC_Os11g14750 | intergenic_region ; MODIFIER | silent_mutation | Average:24.02; most accessible tissue: Zhenshan97 flag leaf, score: 39.027 | N | N | N | N |
| vg1108308382 | C -> DEL | N | N | silent_mutation | Average:24.02; most accessible tissue: Zhenshan97 flag leaf, score: 39.027 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1108308382 | NA | 8.63E-13 | mr1183 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108308382 | NA | 8.62E-13 | mr1503 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108308382 | NA | 4.52E-30 | mr1877 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108308382 | NA | 1.21E-07 | mr1877 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108308382 | NA | 2.77E-09 | mr1929 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |