\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1108308382:

Variant ID: vg1108308382 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 8308382
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, A: 0.04, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


GAAGAAAAAAAAGAGGAAAATGAAAAAAAGACAAAAAATAGATGTAGGGCTATTATCCACCACGGAGGCCCGAACCAGCATAAAATCTATGTGTCCTCCG[C/A]
CTTCTTTTTATTTATTTGTGTGATTGATAATTTGTGGAAAAACCCCAAGGCTAACGCTTGATCAGCGAAAAAGGCCAGGGGGGCGAAATGAATCGGCCGA

Reverse complement sequence

TCGGCCGATTCATTTCGCCCCCCTGGCCTTTTTCGCTGATCAAGCGTTAGCCTTGGGGTTTTTCCACAAATTATCAATCACACAAATAAATAAAAAGAAG[G/T]
CGGAGGACACATAGATTTTATGCTGGTTCGGGCCTCCGTGGTGGATAATAGCCCTACATCTATTTTTTGTCTTTTTTTCATTTTCCTCTTTTTTTTCTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.20% 29.90% 1.84% 0.04% NA
All Indica  2759 50.30% 48.80% 0.91% 0.00% NA
All Japonica  1512 93.50% 2.30% 4.03% 0.13% NA
Aus  269 97.80% 1.90% 0.37% 0.00% NA
Indica I  595 76.80% 22.50% 0.67% 0.00% NA
Indica II  465 17.80% 81.30% 0.86% 0.00% NA
Indica III  913 50.20% 49.20% 0.66% 0.00% NA
Indica Intermediate  786 49.50% 49.10% 1.40% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 86.90% 2.40% 10.52% 0.20% NA
Japonica Intermediate  241 87.10% 9.10% 3.32% 0.41% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 71.10% 28.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1108308382 C -> A LOC_Os11g14730.1 upstream_gene_variant ; 4632.0bp to feature; MODIFIER silent_mutation Average:24.02; most accessible tissue: Zhenshan97 flag leaf, score: 39.027 N N N N
vg1108308382 C -> A LOC_Os11g14740.1 downstream_gene_variant ; 162.0bp to feature; MODIFIER silent_mutation Average:24.02; most accessible tissue: Zhenshan97 flag leaf, score: 39.027 N N N N
vg1108308382 C -> A LOC_Os11g14750.1 downstream_gene_variant ; 1176.0bp to feature; MODIFIER silent_mutation Average:24.02; most accessible tissue: Zhenshan97 flag leaf, score: 39.027 N N N N
vg1108308382 C -> A LOC_Os11g14740-LOC_Os11g14750 intergenic_region ; MODIFIER silent_mutation Average:24.02; most accessible tissue: Zhenshan97 flag leaf, score: 39.027 N N N N
vg1108308382 C -> DEL N N silent_mutation Average:24.02; most accessible tissue: Zhenshan97 flag leaf, score: 39.027 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1108308382 NA 8.63E-13 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108308382 NA 8.62E-13 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108308382 NA 4.52E-30 mr1877 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108308382 NA 1.21E-07 mr1877 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108308382 NA 2.77E-09 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251