\
| Variant ID: vg1108255008 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 8255008 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GGGAGGGTCTTCATCTGTTGTTCATCCGCAACGTCAGTTCTTCAACAATAATGCTGGCAACAACAACCGCAACCAAGCTCTACGCCCTGTTGCAACTCTA[A/G]
TTCAGCATCAACCTGCCAAGAGGGAGCAAGGAAACAAGCCAGGAGTGTGCTTTAACTGTGGGGAACTAGGTCATTACTCCGACAAGTGTCCGAAGCCCCG
CGGGGCTTCGGACACTTGTCGGAGTAATGACCTAGTTCCCCACAGTTAAAGCACACTCCTGGCTTGTTTCCTTGCTCCCTCTTGGCAGGTTGATGCTGAA[T/C]
TAGAGTTGCAACAGGGCGTAGAGCTTGGTTGCGGTTGTTGTTGCCAGCATTATTGTTGAAGAACTGACGTTGCGGATGAACAACAGATGAAGACCCTCCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.80% | 0.50% | 13.18% | 45.56% | NA |
| All Indica | 2759 | 7.50% | 0.20% | 20.88% | 71.40% | NA |
| All Japonica | 1512 | 92.30% | 0.90% | 0.79% | 6.08% | NA |
| Aus | 269 | 73.20% | 0.70% | 7.81% | 18.22% | NA |
| Indica I | 595 | 11.90% | 0.00% | 9.75% | 78.32% | NA |
| Indica II | 465 | 5.20% | 0.00% | 19.35% | 75.48% | NA |
| Indica III | 913 | 2.30% | 0.00% | 30.23% | 67.47% | NA |
| Indica Intermediate | 786 | 11.60% | 0.80% | 19.34% | 68.32% | NA |
| Temperate Japonica | 767 | 97.90% | 0.00% | 0.26% | 1.83% | NA |
| Tropical Japonica | 504 | 86.50% | 2.60% | 1.39% | 9.52% | NA |
| Japonica Intermediate | 241 | 86.30% | 0.00% | 1.24% | 12.45% | NA |
| VI/Aromatic | 96 | 89.60% | 0.00% | 2.08% | 8.33% | NA |
| Intermediate | 90 | 46.70% | 2.20% | 13.33% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1108255008 | A -> DEL | LOC_Os11g14650.1 | N | frameshift_variant | Average:12.502; most accessible tissue: Callus, score: 35.737 | N | N | N | N |
| vg1108255008 | A -> G | LOC_Os11g14650.1 | missense_variant ; p.Ile294Val; MODERATE | nonsynonymous_codon ; I294V | Average:12.502; most accessible tissue: Callus, score: 35.737 | benign |
-1.045 |
TOLERATED | 0.53 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1108255008 | 4.95E-06 | NA | mr1030_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108255008 | NA | 7.99E-06 | mr1066_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108255008 | 2.78E-06 | 2.78E-06 | mr1066_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108255008 | 8.13E-06 | NA | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108255008 | 4.47E-06 | 4.47E-06 | mr1329_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108255008 | 3.09E-06 | NA | mr1442_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108255008 | 1.13E-07 | 3.67E-06 | mr1442_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108255008 | 5.27E-06 | NA | mr1550_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108255008 | 3.64E-06 | 6.09E-06 | mr1757_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |