Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1108104330:

Variant ID: vg1108104330 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 8104330
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACACACCTTGAACATCTCAATGTTGACAACACCTGGCCCCTTCCCTTGGATTATCTTTCTCAGCTCCTCCTCACCCAACCCCTTGGGTACATTACCAAC[G/A]
AATAGCCTGTGCTTTGCCTGCGACAGTGAGCACCGCAGTGTCCTCCCCTGCACCAAAGACCAAACCATCCAATGTAAGCACATCATACGTGATAGAACAA

Reverse complement sequence

TTGTTCTATCACGTATGATGTGCTTACATTGGATGGTTTGGTCTTTGGTGCAGGGGAGGACACTGCGGTGCTCACTGTCGCAGGCAAAGCACAGGCTATT[C/T]
GTTGGTAATGTACCCAAGGGGTTGGGTGAGGAGGAGCTGAGAAAGATAATCCAAGGGAAGGGGCCAGGTGTTGTCAACATTGAGATGTTCAAGGTGTGTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.20% 37.50% 0.19% 0.06% NA
All Indica  2759 96.10% 3.60% 0.22% 0.07% NA
All Japonica  1512 10.20% 89.70% 0.07% 0.00% NA
Aus  269 27.90% 72.10% 0.00% 0.00% NA
Indica I  595 93.80% 5.90% 0.34% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 98.80% 0.90% 0.22% 0.11% NA
Indica Intermediate  786 92.60% 7.10% 0.13% 0.13% NA
Temperate Japonica  767 2.00% 98.00% 0.00% 0.00% NA
Tropical Japonica  504 19.80% 80.20% 0.00% 0.00% NA
Japonica Intermediate  241 16.20% 83.40% 0.41% 0.00% NA
VI/Aromatic  96 10.40% 89.60% 0.00% 0.00% NA
Intermediate  90 55.60% 41.10% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1108104330 G -> A LOC_Os11g14430.2 synonymous_variant ; p.Phe187Phe; LOW synonymous_codon Average:76.178; most accessible tissue: Minghui63 flag leaf, score: 83.621 N N N N
vg1108104330 G -> A LOC_Os11g14430.1 synonymous_variant ; p.Phe187Phe; LOW synonymous_codon Average:76.178; most accessible tissue: Minghui63 flag leaf, score: 83.621 N N N N
vg1108104330 G -> DEL LOC_Os11g14430.2 N frameshift_variant Average:76.178; most accessible tissue: Minghui63 flag leaf, score: 83.621 N N N N
vg1108104330 G -> DEL LOC_Os11g14430.1 N frameshift_variant Average:76.178; most accessible tissue: Minghui63 flag leaf, score: 83.621 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1108104330 G A -0.02 -0.01 -0.02 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1108104330 NA 5.44E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108104330 NA 5.48E-08 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108104330 8.86E-07 3.00E-12 mr1188 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108104330 2.63E-06 4.67E-08 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108104330 NA 4.30E-31 mr1224 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108104330 NA 7.50E-14 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108104330 NA 8.88E-06 mr1672 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108104330 NA 4.08E-08 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108104330 NA 8.94E-22 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108104330 NA 5.59E-14 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108104330 NA 2.71E-07 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108104330 NA 6.02E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108104330 NA 3.78E-22 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108104330 NA 3.29E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108104330 NA 3.34E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108104330 NA 2.15E-25 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251