\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1108064762:

Variant ID: vg1108064762 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 8064762
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, A: 0.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TATCTTATTCTAACATGAATATGCATTGCAAGCATAACTAGTTCTCTTTTATTTTATTAATATTGACGGGTGAAACTAATCGATAATGACCGTCAACAGA[C/A]
ACCATCAAGGAAACAGAGATGCTAGCCGCAAAGTTGGACCTCCTGATGAAAATGTTGGACAATCAGGACAAAAGCCAGCCTCAAGGAACCGTGAAGGCAT

Reverse complement sequence

ATGCCTTCACGGTTCCTTGAGGCTGGCTTTTGTCCTGATTGTCCAACATTTTCATCAGGAGGTCCAACTTTGCGGCTAGCATCTCTGTTTCCTTGATGGT[G/T]
TCTGTTGACGGTCATTATCGATTAGTTTCACCCGTCAATATTAATAAAATAAAAGAGAACTAGTTATGCTTGCAATGCATATTCATGTTAGAATAAGATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.70% 37.30% 0.06% 1.93% NA
All Indica  2759 38.10% 61.70% 0.11% 0.04% NA
All Japonica  1512 93.10% 1.90% 0.00% 5.03% NA
Aus  269 97.80% 0.40% 0.00% 1.86% NA
Indica I  595 20.70% 79.30% 0.00% 0.00% NA
Indica II  465 12.30% 87.70% 0.00% 0.00% NA
Indica III  913 59.50% 40.40% 0.00% 0.11% NA
Indica Intermediate  786 41.90% 57.80% 0.38% 0.00% NA
Temperate Japonica  767 98.30% 1.70% 0.00% 0.00% NA
Tropical Japonica  504 85.30% 2.60% 0.00% 12.10% NA
Japonica Intermediate  241 92.90% 0.80% 0.00% 6.22% NA
VI/Aromatic  96 91.70% 0.00% 0.00% 8.33% NA
Intermediate  90 64.40% 34.40% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1108064762 C -> A LOC_Os11g14360.1 missense_variant&splice_region_variant ; p.Asp88Glu; MODERATE nonsynonymous_codon ; D88E Average:45.689; most accessible tissue: Zhenshan97 young leaf, score: 77.101 unknown unknown TOLERATED 0.30
vg1108064762 C -> DEL LOC_Os11g14360.1 N frameshift_variant Average:45.689; most accessible tissue: Zhenshan97 young leaf, score: 77.101 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1108064762 NA 4.38E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108064762 NA 1.44E-20 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108064762 NA 4.98E-07 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108064762 NA 1.78E-15 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108064762 1.10E-06 1.10E-06 mr1770 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108064762 NA 4.06E-18 mr1870 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108064762 NA 3.04E-07 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108064762 NA 5.36E-06 mr1975 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108064762 NA 3.25E-11 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108064762 NA 2.10E-19 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251