Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1108064762:

Variant ID: vg1108064762 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 8064762
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, A: 0.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

TATCTTATTCTAACATGAATATGCATTGCAAGCATAACTAGTTCTCTTTTATTTTATTAATATTGACGGGTGAAACTAATCGATAATGACCGTCAACAGA[C/A]
ACCATCAAGGAAACAGAGATGCTAGCCGCAAAGTTGGACCTCCTGATGAAAATGTTGGACAATCAGGACAAAAGCCAGCCTCAAGGAACCGTGAAGGCAT

Reverse complement sequence

ATGCCTTCACGGTTCCTTGAGGCTGGCTTTTGTCCTGATTGTCCAACATTTTCATCAGGAGGTCCAACTTTGCGGCTAGCATCTCTGTTTCCTTGATGGT[G/T]
TCTGTTGACGGTCATTATCGATTAGTTTCACCCGTCAATATTAATAAAATAAAAGAGAACTAGTTATGCTTGCAATGCATATTCATGTTAGAATAAGATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.70%	37.30%	0.06%	1.93%	NA
All Indica	2759	38.10%	61.70%	0.11%	0.04%	NA
All Japonica	1512	93.10%	1.90%	0.00%	5.03%	NA
Aus	269	97.80%	0.40%	0.00%	1.86%	NA
Indica I	595	20.70%	79.30%	0.00%	0.00%	NA
Indica II	465	12.30%	87.70%	0.00%	0.00%	NA
Indica III	913	59.50%	40.40%	0.00%	0.11%	NA
Indica Intermediate	786	41.90%	57.80%	0.38%	0.00%	NA
Temperate Japonica	767	98.30%	1.70%	0.00%	0.00%	NA
Tropical Japonica	504	85.30%	2.60%	0.00%	12.10%	NA
Japonica Intermediate	241	92.90%	0.80%	0.00%	6.22%	NA
VI/Aromatic	96	91.70%	0.00%	0.00%	8.33%	NA
Intermediate	90	64.40%	34.40%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1108064762	C -> A	LOC_Os11g14360.1	missense_variant&splice_region_variant ; p.Asp88Glu; MODERATE	nonsynonymous_codon ; D88E	Average:45.689; most accessible tissue: Zhenshan97 young leaf, score: 77.101	unknown	unknown	TOLERATED	0.30
vg1108064762	C -> DEL	LOC_Os11g14360.1	N	frameshift_variant	Average:45.689; most accessible tissue: Zhenshan97 young leaf, score: 77.101	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1108064762	NA	4.38E-06	mr1042	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108064762	NA	1.44E-20	mr1422	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108064762	NA	4.98E-07	mr1479	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108064762	NA	1.78E-15	mr1583	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108064762	1.10E-06	1.10E-06	mr1770	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108064762	NA	4.06E-18	mr1870	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108064762	NA	3.04E-07	mr1950	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108064762	NA	5.36E-06	mr1975	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108064762	NA	3.25E-11	mr1850_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108064762	NA	2.10E-19	mr1870_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251