\
| Variant ID: vg1108064762 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 8064762 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, A: 0.01, others allele: 0.00, population size: 109. )
TATCTTATTCTAACATGAATATGCATTGCAAGCATAACTAGTTCTCTTTTATTTTATTAATATTGACGGGTGAAACTAATCGATAATGACCGTCAACAGA[C/A]
ACCATCAAGGAAACAGAGATGCTAGCCGCAAAGTTGGACCTCCTGATGAAAATGTTGGACAATCAGGACAAAAGCCAGCCTCAAGGAACCGTGAAGGCAT
ATGCCTTCACGGTTCCTTGAGGCTGGCTTTTGTCCTGATTGTCCAACATTTTCATCAGGAGGTCCAACTTTGCGGCTAGCATCTCTGTTTCCTTGATGGT[G/T]
TCTGTTGACGGTCATTATCGATTAGTTTCACCCGTCAATATTAATAAAATAAAAGAGAACTAGTTATGCTTGCAATGCATATTCATGTTAGAATAAGATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.70% | 37.30% | 0.06% | 1.93% | NA |
| All Indica | 2759 | 38.10% | 61.70% | 0.11% | 0.04% | NA |
| All Japonica | 1512 | 93.10% | 1.90% | 0.00% | 5.03% | NA |
| Aus | 269 | 97.80% | 0.40% | 0.00% | 1.86% | NA |
| Indica I | 595 | 20.70% | 79.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 12.30% | 87.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 59.50% | 40.40% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 41.90% | 57.80% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 85.30% | 2.60% | 0.00% | 12.10% | NA |
| Japonica Intermediate | 241 | 92.90% | 0.80% | 0.00% | 6.22% | NA |
| VI/Aromatic | 96 | 91.70% | 0.00% | 0.00% | 8.33% | NA |
| Intermediate | 90 | 64.40% | 34.40% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1108064762 | C -> A | LOC_Os11g14360.1 | missense_variant&splice_region_variant ; p.Asp88Glu; MODERATE | nonsynonymous_codon ; D88E | Average:45.689; most accessible tissue: Zhenshan97 young leaf, score: 77.101 | unknown | unknown | TOLERATED | 0.30 |
| vg1108064762 | C -> DEL | LOC_Os11g14360.1 | N | frameshift_variant | Average:45.689; most accessible tissue: Zhenshan97 young leaf, score: 77.101 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1108064762 | NA | 4.38E-06 | mr1042 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108064762 | NA | 1.44E-20 | mr1422 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108064762 | NA | 4.98E-07 | mr1479 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108064762 | NA | 1.78E-15 | mr1583 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108064762 | 1.10E-06 | 1.10E-06 | mr1770 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108064762 | NA | 4.06E-18 | mr1870 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108064762 | NA | 3.04E-07 | mr1950 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108064762 | NA | 5.36E-06 | mr1975 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108064762 | NA | 3.25E-11 | mr1850_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108064762 | NA | 2.10E-19 | mr1870_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |