\
| Variant ID: vg1108050776 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 8050776 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 101. )
TGGGTCATCGTCGATTCCTTGCAGCAAACCACCCAGTACGGAAGAAAGGCAAGCACTTCGAACATAAGGCCGACCACCGTACGAAGCCTAAACATCGCAG[C/T]
GGGAAAACAATGTTTGATATGGTTAAAGATCTTAAAGTAGTGTTCGAAAAGGGGCCTGGAAGCCAGCCTATAGAGAGCGAATATGGTCACGCGGCGATGT
ACATCGCCGCGTGACCATATTCGCTCTCTATAGGCTGGCTTCCAGGCCCCTTTTCGAACACTACTTTAAGATCTTTAACCATATCAAACATTGTTTTCCC[G/A]
CTGCGATGTTTAGGCTTCGTACGGTGGTCGGCCTTATGTTCGAAGTGCTTGCCTTTCTTCCGTACTGGGTGGTTTGCTGCAAGGAATCGACGATGACCCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.60% | 37.20% | 0.32% | 1.86% | NA |
| All Indica | 2759 | 37.80% | 61.50% | 0.47% | 0.14% | NA |
| All Japonica | 1512 | 93.30% | 1.90% | 0.00% | 4.83% | NA |
| Aus | 269 | 98.50% | 0.40% | 0.00% | 1.12% | NA |
| Indica I | 595 | 20.50% | 78.30% | 1.01% | 0.17% | NA |
| Indica II | 465 | 12.30% | 87.30% | 0.22% | 0.22% | NA |
| Indica III | 913 | 58.90% | 40.70% | 0.22% | 0.11% | NA |
| Indica Intermediate | 786 | 41.60% | 57.80% | 0.51% | 0.13% | NA |
| Temperate Japonica | 767 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 85.30% | 2.60% | 0.00% | 12.10% | NA |
| Japonica Intermediate | 241 | 94.20% | 0.80% | 0.00% | 4.98% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 0.00% | 5.21% | NA |
| Intermediate | 90 | 61.10% | 33.30% | 2.22% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1108050776 | C -> T | LOC_Os11g14340.1 | synonymous_variant ; p.Ser452Ser; LOW | synonymous_codon | Average:31.128; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 | N | N | N | N |
| vg1108050776 | C -> DEL | LOC_Os11g14340.1 | N | frameshift_variant | Average:31.128; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1108050776 | NA | 4.90E-07 | mr1042 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108050776 | NA | 1.27E-06 | mr1043 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108050776 | NA | 7.29E-06 | mr1185 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108050776 | 2.61E-06 | 9.04E-08 | mr1479 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108050776 | NA | 4.89E-06 | mr1698 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108050776 | NA | 6.05E-18 | mr1870 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108050776 | NA | 8.53E-06 | mr1912 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108050776 | NA | 6.42E-08 | mr1950 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108050776 | NA | 1.59E-06 | mr1975 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1108050776 | NA | 7.93E-20 | mr1870_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |