\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1107883533:

Variant ID: vg1107883533 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 7883533
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.02, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


TGAAAAAAATTACGTTGCAAATAGTTTAAAATCAACTTTAAAATTAAGTTTGAAAATTTAAATTTTTTTCTTTGGTTTTGACTTATTAGGACAACCAATG[G/T]
GGCTAAACATCTTCCATGTTTTTTTATTTTCTTTATTGAAACAGTACCATAGTCCCAAGGCTTTGATCATCTAATTAGTTAATTGAGATTACCAGCTTAA

Reverse complement sequence

TTAAGCTGGTAATCTCAATTAACTAATTAGATGATCAAAGCCTTGGGACTATGGTACTGTTTCAATAAAGAAAATAAAAAAACATGGAAGATGTTTAGCC[C/A]
CATTGGTTGTCCTAATAAGTCAAAACCAAAGAAAAAAATTTAAATTTTCAAACTTAATTTTAAAGTTGATTTTAAACTATTTGCAACGTAATTTTTTTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.40% 33.30% 0.28% 0.00% NA
All Indica  2759 45.60% 54.00% 0.47% 0.00% NA
All Japonica  1512 96.40% 3.60% 0.00% 0.00% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 28.60% 70.90% 0.50% 0.00% NA
Indica II  465 33.10% 66.50% 0.43% 0.00% NA
Indica III  913 58.40% 41.20% 0.44% 0.00% NA
Indica Intermediate  786 50.90% 48.60% 0.51% 0.00% NA
Temperate Japonica  767 98.30% 1.70% 0.00% 0.00% NA
Tropical Japonica  504 96.80% 3.20% 0.00% 0.00% NA
Japonica Intermediate  241 89.20% 10.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 71.10% 28.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1107883533 G -> T LOC_Os11g14140.1 upstream_gene_variant ; 3985.0bp to feature; MODIFIER silent_mutation Average:65.74; most accessible tissue: Callus, score: 93.761 N N N N
vg1107883533 G -> T LOC_Os11g14140-LOC_Os11g14150 intergenic_region ; MODIFIER silent_mutation Average:65.74; most accessible tissue: Callus, score: 93.761 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1107883533 G T -0.07 -0.04 -0.03 -0.03 -0.04 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1107883533 NA 9.10E-08 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107883533 NA 2.14E-06 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107883533 NA 2.30E-07 mr1743 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107883533 NA 4.83E-06 mr1806 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107883533 NA 5.02E-21 mr1870 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107883533 NA 9.76E-08 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107883533 NA 1.71E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107883533 NA 1.59E-19 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251