\
| Variant ID: vg1107881424 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 7881424 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTCAGCTCTTAATAATCTGGGCTGAAAAACCTAGTTTCTAACTAATAGTATCTAAATTCTACGGCTACACATTCTAAAATTCTGAGTGAAATCCTGGACT[G/A]
TTTAGGGGAGCTTCTGGCAGCTGGAGATTCTTAGATAAGCTGCAACCGTCAGAAACTCCCTTGATAGACTCCTAGAACCTATCAGAGGGGACTTTTAGCA
TGCTAAAAGTCCCCTCTGATAGGTTCTAGGAGTCTATCAAGGGAGTTTCTGACGGTTGCAGCTTATCTAAGAATCTCCAGCTGCCAGAAGCTCCCCTAAA[C/T]
AGTCCAGGATTTCACTCAGAATTTTAGAATGTGTAGCCGTAGAATTTAGATACTATTAGTTAGAAACTAGGTTTTTCAGCCCAGATTATTAAGAGCTGAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.70% | 19.20% | 13.42% | 2.75% | NA |
| All Indica | 2759 | 71.60% | 2.70% | 21.20% | 4.46% | NA |
| All Japonica | 1512 | 56.00% | 42.60% | 1.19% | 0.20% | NA |
| Aus | 269 | 39.00% | 53.90% | 7.06% | 0.00% | NA |
| Indica I | 595 | 88.60% | 0.80% | 8.91% | 1.68% | NA |
| Indica II | 465 | 61.10% | 0.40% | 33.55% | 4.95% | NA |
| Indica III | 913 | 72.10% | 1.80% | 19.82% | 6.35% | NA |
| Indica Intermediate | 786 | 64.50% | 6.60% | 24.81% | 4.07% | NA |
| Temperate Japonica | 767 | 84.40% | 14.90% | 0.78% | 0.00% | NA |
| Tropical Japonica | 504 | 20.00% | 79.20% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 41.10% | 54.40% | 3.32% | 1.24% | NA |
| VI/Aromatic | 96 | 79.20% | 19.80% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 25.60% | 12.22% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1107881424 | G -> A | LOC_Os11g14140.1 | upstream_gene_variant ; 1876.0bp to feature; MODIFIER | silent_mutation | Average:75.877; most accessible tissue: Zhenshan97 root, score: 88.397 | N | N | N | N |
| vg1107881424 | G -> A | LOC_Os11g14140-LOC_Os11g14150 | intergenic_region ; MODIFIER | silent_mutation | Average:75.877; most accessible tissue: Zhenshan97 root, score: 88.397 | N | N | N | N |
| vg1107881424 | G -> DEL | N | N | silent_mutation | Average:75.877; most accessible tissue: Zhenshan97 root, score: 88.397 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1107881424 | NA | 6.85E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107881424 | NA | 1.07E-06 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107881424 | NA | 1.58E-07 | mr1042_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107881424 | NA | 2.45E-07 | mr1064_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107881424 | NA | 8.80E-06 | mr1269_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107881424 | NA | 5.19E-06 | mr1295_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107881424 | NA | 2.10E-09 | mr1502_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107881424 | NA | 1.28E-07 | mr1502_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107881424 | NA | 4.12E-11 | mr1543_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107881424 | NA | 4.20E-09 | mr1543_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107881424 | NA | 2.07E-12 | mr1680_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107881424 | NA | 3.86E-06 | mr1704_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107881424 | NA | 1.85E-15 | mr1742_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107881424 | 1.42E-06 | 1.42E-06 | mr1777_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107881424 | NA | 5.80E-09 | mr1871_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |