\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1107881424:

Variant ID: vg1107881424 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 7881424
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCAGCTCTTAATAATCTGGGCTGAAAAACCTAGTTTCTAACTAATAGTATCTAAATTCTACGGCTACACATTCTAAAATTCTGAGTGAAATCCTGGACT[G/A]
TTTAGGGGAGCTTCTGGCAGCTGGAGATTCTTAGATAAGCTGCAACCGTCAGAAACTCCCTTGATAGACTCCTAGAACCTATCAGAGGGGACTTTTAGCA

Reverse complement sequence

TGCTAAAAGTCCCCTCTGATAGGTTCTAGGAGTCTATCAAGGGAGTTTCTGACGGTTGCAGCTTATCTAAGAATCTCCAGCTGCCAGAAGCTCCCCTAAA[C/T]
AGTCCAGGATTTCACTCAGAATTTTAGAATGTGTAGCCGTAGAATTTAGATACTATTAGTTAGAAACTAGGTTTTTCAGCCCAGATTATTAAGAGCTGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.70% 19.20% 13.42% 2.75% NA
All Indica  2759 71.60% 2.70% 21.20% 4.46% NA
All Japonica  1512 56.00% 42.60% 1.19% 0.20% NA
Aus  269 39.00% 53.90% 7.06% 0.00% NA
Indica I  595 88.60% 0.80% 8.91% 1.68% NA
Indica II  465 61.10% 0.40% 33.55% 4.95% NA
Indica III  913 72.10% 1.80% 19.82% 6.35% NA
Indica Intermediate  786 64.50% 6.60% 24.81% 4.07% NA
Temperate Japonica  767 84.40% 14.90% 0.78% 0.00% NA
Tropical Japonica  504 20.00% 79.20% 0.79% 0.00% NA
Japonica Intermediate  241 41.10% 54.40% 3.32% 1.24% NA
VI/Aromatic  96 79.20% 19.80% 1.04% 0.00% NA
Intermediate  90 57.80% 25.60% 12.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1107881424 G -> A LOC_Os11g14140.1 upstream_gene_variant ; 1876.0bp to feature; MODIFIER silent_mutation Average:75.877; most accessible tissue: Zhenshan97 root, score: 88.397 N N N N
vg1107881424 G -> A LOC_Os11g14140-LOC_Os11g14150 intergenic_region ; MODIFIER silent_mutation Average:75.877; most accessible tissue: Zhenshan97 root, score: 88.397 N N N N
vg1107881424 G -> DEL N N silent_mutation Average:75.877; most accessible tissue: Zhenshan97 root, score: 88.397 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1107881424 NA 6.85E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107881424 NA 1.07E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107881424 NA 1.58E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107881424 NA 2.45E-07 mr1064_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107881424 NA 8.80E-06 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107881424 NA 5.19E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107881424 NA 2.10E-09 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107881424 NA 1.28E-07 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107881424 NA 4.12E-11 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107881424 NA 4.20E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107881424 NA 2.07E-12 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107881424 NA 3.86E-06 mr1704_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107881424 NA 1.85E-15 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107881424 1.42E-06 1.42E-06 mr1777_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107881424 NA 5.80E-09 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251