Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1107675284:

Variant ID: vg1107675284 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 7675284
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.72, C: 0.28, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


TATGATACAGTAAACATTTGCTAATAACGGATTAATTAGGCTTAAAAATTCATCTCGCAGTTTACAGGCGGAATCTGTAATTTGTTTTATTATTAGTCTA[C/T]
ATTTAATACTTTAAATGTGTGTCGGTATACTTAAAAAAATTTTGGCACACAAACTAGACAATGAAATTACAGAGAGCAGCTGATGGTGTTATGATGCCAA

Reverse complement sequence

TTGGCATCATAACACCATCAGCTGCTCTCTGTAATTTCATTGTCTAGTTTGTGTGCCAAAATTTTTTTAAGTATACCGACACACATTTAAAGTATTAAAT[G/A]
TAGACTAATAATAAAACAAATTACAGATTCCGCCTGTAAACTGCGAGATGAATTTTTAAGCCTAATTAATCCGTTATTAGCAAATGTTTACTGTATCATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.00% 39.50% 0.13% 0.44% NA
All Indica  2759 95.40% 4.20% 0.14% 0.33% NA
All Japonica  1512 7.90% 91.40% 0.07% 0.60% NA
Aus  269 12.60% 87.40% 0.00% 0.00% NA
Indica I  595 97.00% 2.20% 0.50% 0.34% NA
Indica II  465 98.70% 1.10% 0.00% 0.22% NA
Indica III  913 98.10% 1.60% 0.00% 0.22% NA
Indica Intermediate  786 88.90% 10.40% 0.13% 0.51% NA
Temperate Japonica  767 3.50% 96.00% 0.00% 0.52% NA
Tropical Japonica  504 10.30% 88.90% 0.20% 0.60% NA
Japonica Intermediate  241 17.00% 82.20% 0.00% 0.83% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 51.10% 44.40% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1107675284 C -> T LOC_Os11g13900.1 downstream_gene_variant ; 3402.0bp to feature; MODIFIER silent_mutation Average:49.311; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg1107675284 C -> T LOC_Os11g13890-LOC_Os11g13900 intergenic_region ; MODIFIER silent_mutation Average:49.311; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg1107675284 C -> DEL N N silent_mutation Average:49.311; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1107675284 NA 2.10E-26 mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107675284 NA 2.85E-31 mr1085 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107675284 8.18E-06 1.36E-33 mr1086 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107675284 4.24E-06 1.31E-63 mr1088 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107675284 NA 1.07E-35 mr1104 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107675284 NA 1.20E-39 mr1139 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107675284 NA 8.76E-16 mr1147 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107675284 NA 2.42E-18 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107675284 NA 1.71E-16 mr1199 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107675284 NA 5.87E-37 mr1213 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107675284 NA 2.00E-06 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107675284 NA 2.75E-36 mr1224 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107675284 3.94E-06 3.73E-09 mr1224 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107675284 2.73E-06 2.81E-38 mr1225 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107675284 NA 2.94E-06 mr1225 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107675284 NA 5.06E-13 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107675284 NA 6.10E-07 mr1243 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107675284 NA 2.43E-61 mr1246 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107675284 NA 7.95E-06 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107675284 NA 4.23E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107675284 NA 2.84E-09 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107675284 NA 2.08E-36 mr1404 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107675284 NA 5.11E-29 mr1436 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107675284 7.42E-06 1.95E-43 mr1437 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107675284 NA 3.76E-08 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107675284 NA 7.67E-25 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107675284 NA 1.71E-42 mr1620 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107675284 NA 7.73E-06 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107675284 NA 9.55E-06 mr1734 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107675284 NA 4.12E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107675284 NA 1.48E-14 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107675284 NA 3.75E-07 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107675284 NA 3.36E-15 mr1870 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107675284 NA 3.75E-32 mr1878 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107675284 NA 1.85E-22 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107675284 NA 6.99E-07 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251