RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1107674285:

Variant ID: vg1107674285 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 7674285
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCCGTTCGTTTCCACTACAAAGACCGGATGTTTGGATTTTCGTGGTACGCTTTTTAAACTGCTAAACGGTGCATTTCGTGCGAAAACTTTCTATATGAAA[A/G]
TTGTTCTAAAATATCAGATTAATCCATTTTTTAAGTCTGTAATAATTAAAACTCAATTAAGCACACGTTATTAGCATCTCGTTTTACGTGAAACACTTAA

Reverse complement sequence

TTAAGTGTTTCACGTAAAACGAGATGCTAATAACGTGTGCTTAATTGAGTTTTAATTATTACAGACTTAAAAAATGGATTAATCTGATATTTTAGAACAA[T/C]
TTTCATATAGAAAGTTTTCGCACGAAATGCACCGTTTAGCAGTTTAAAAAGCGTACCACGAAAATCCAAACATCCGGTCTTTGTAGTGGAAACGAACGGG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.40%	39.30%	0.34%	0.00%	NA
All Indica	2759	95.90%	3.90%	0.22%	0.00%	NA
All Japonica	1512	8.30%	91.20%	0.53%	0.00%	NA
Aus	269	12.60%	87.40%	0.00%	0.00%	NA
Indica I	595	97.80%	1.80%	0.34%	0.00%	NA
Indica II	465	99.10%	0.60%	0.22%	0.00%	NA
Indica III	913	98.20%	1.60%	0.11%	0.00%	NA
Indica Intermediate	786	89.70%	10.10%	0.25%	0.00%	NA
Temperate Japonica	767	3.80%	95.70%	0.52%	0.00%	NA
Tropical Japonica	504	10.90%	88.70%	0.40%	0.00%	NA
Japonica Intermediate	241	17.00%	82.20%	0.83%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	54.40%	43.30%	2.22%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1107674285	A -> G	LOC_Os11g13900.1	downstream_gene_variant ; 4401.0bp to feature; MODIFIER	silent_mutation	Average:26.963; most accessible tissue: Callus, score: 53.83	N	N	N	N
vg1107674285	A -> G	LOC_Os11g13890-LOC_Os11g13900	intergenic_region ; MODIFIER	silent_mutation	Average:26.963; most accessible tissue: Callus, score: 53.83	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1107674285	NA	6.52E-07	mr1040	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107674285	NA	9.25E-07	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107674285	NA	5.38E-27	mr1076	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107674285	NA	2.45E-31	mr1085	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107674285	3.20E-06	8.53E-34	mr1086	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107674285	NA	8.01E-06	mr1086	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107674285	NA	1.27E-61	mr1088	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107674285	NA	4.84E-06	mr1088	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107674285	NA	8.16E-36	mr1104	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107674285	NA	8.42E-06	mr1104	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 43 entries

Previous1 2 3 4 5Next

Search for Variation information by Variation ID:

Detailed information for vg1107674285:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact