\
| Variant ID: vg1107619564 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 7619564 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGTCCCTCTATTTGTCGCCCAGTCCGATTTCCGTGCCTTGACCGCAAAAAGGATACGACTCATCCCCCAACTTCCGAAAACCGGGCAAACGAGGTCCCTC[G/A]
GCGGTTTTGGCTGACGTGGTACCTACATGGCTTGTTTGATTAGTTTTCCATCCCACGTAGCATTGATGTGGTGCTAACGTGACAATTATATCTCAGAAAA
TTTTCTGAGATATAATTGTCACGTTAGCACCACATCAATGCTACGTGGGATGGAAAACTAATCAAACAAGCCATGTAGGTACCACGTCAGCCAAAACCGC[C/T]
GAGGGACCTCGTTTGCCCGGTTTTCGGAAGTTGGGGGATGAGTCGTATCCTTTTTGCGGTCAAGGCACGGAAATCGGACTGGGCGACAAATAGAGGGACA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.70% | 0.40% | 1.95% | 19.93% | NA |
| All Indica | 2759 | 97.80% | 0.10% | 0.94% | 1.12% | NA |
| All Japonica | 1512 | 36.70% | 1.00% | 3.17% | 59.13% | NA |
| Aus | 269 | 96.30% | 0.00% | 3.35% | 0.37% | NA |
| Indica I | 595 | 96.80% | 0.00% | 3.03% | 0.17% | NA |
| Indica II | 465 | 99.60% | 0.00% | 0.00% | 0.43% | NA |
| Indica III | 913 | 98.90% | 0.20% | 0.55% | 0.33% | NA |
| Indica Intermediate | 786 | 96.30% | 0.10% | 0.38% | 3.18% | NA |
| Temperate Japonica | 767 | 43.30% | 1.00% | 4.04% | 51.63% | NA |
| Tropical Japonica | 504 | 25.80% | 1.20% | 2.38% | 70.63% | NA |
| Japonica Intermediate | 241 | 38.60% | 0.40% | 2.07% | 58.92% | NA |
| VI/Aromatic | 96 | 91.70% | 0.00% | 6.25% | 2.08% | NA |
| Intermediate | 90 | 81.10% | 0.00% | 3.33% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1107619564 | G -> A | LOC_Os11g13830.1 | upstream_gene_variant ; 435.0bp to feature; MODIFIER | silent_mutation | Average:77.285; most accessible tissue: Callus, score: 95.947 | N | N | N | N |
| vg1107619564 | G -> A | LOC_Os11g13820.1 | downstream_gene_variant ; 829.0bp to feature; MODIFIER | silent_mutation | Average:77.285; most accessible tissue: Callus, score: 95.947 | N | N | N | N |
| vg1107619564 | G -> A | LOC_Os11g13820-LOC_Os11g13830 | intergenic_region ; MODIFIER | silent_mutation | Average:77.285; most accessible tissue: Callus, score: 95.947 | N | N | N | N |
| vg1107619564 | G -> DEL | N | N | silent_mutation | Average:77.285; most accessible tissue: Callus, score: 95.947 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1107619564 | NA | 2.65E-06 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107619564 | NA | 6.83E-06 | mr1807 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107619564 | 9.76E-07 | NA | mr1672_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |