\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1107589818:

Variant ID: vg1107589818 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 7589818
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTATATATCTGTGTTCATTCATTAAGTCTATTCGTTATTTGTGCATTAGAGTAAATGGACATTGATGCATGCATCTATATACAAAAGTATTTATAACCC[A/G]
CATGTAATATCTTGATTTGCTATTGGCTAGAAAGTAGTGAGGATGATGCATGTATTGAGTTTGTTGCTAGAGTAAATATAGTATGAAAGAGTTATTAGTT

Reverse complement sequence

AACTAATAACTCTTTCATACTATATTTACTCTAGCAACAAACTCAATACATGCATCATCCTCACTACTTTCTAGCCAATAGCAAATCAAGATATTACATG[T/C]
GGGTTATAAATACTTTTGTATATAGATGCATGCATCAATGTCCATTTACTCTAATGCACAAATAACGAATAGACTTAATGAATGAACACAGATATATAGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.90% 8.00% 0.19% 0.00% NA
All Indica  2759 99.30% 0.70% 0.00% 0.00% NA
All Japonica  1512 76.30% 23.10% 0.53% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 1.70% 0.00% 0.00% NA
Temperate Japonica  767 98.00% 1.30% 0.65% 0.00% NA
Tropical Japonica  504 38.90% 60.90% 0.20% 0.00% NA
Japonica Intermediate  241 85.50% 13.70% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 7.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1107589818 A -> G LOC_Os11g13800.1 upstream_gene_variant ; 1454.0bp to feature; MODIFIER silent_mutation Average:41.99; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg1107589818 A -> G LOC_Os11g13800.2 upstream_gene_variant ; 1454.0bp to feature; MODIFIER silent_mutation Average:41.99; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg1107589818 A -> G LOC_Os11g13800.3 upstream_gene_variant ; 1454.0bp to feature; MODIFIER silent_mutation Average:41.99; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg1107589818 A -> G LOC_Os11g13800-LOC_Os11g13810 intergenic_region ; MODIFIER silent_mutation Average:41.99; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1107589818 NA 1.13E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107589818 NA 3.53E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107589818 NA 1.79E-07 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107589818 NA 1.41E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107589818 NA 1.81E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107589818 NA 5.35E-08 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107589818 2.68E-07 6.06E-11 mr1742 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107589818 NA 2.51E-09 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107589818 NA 1.12E-06 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107589818 NA 1.07E-11 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107589818 NA 1.76E-07 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107589818 NA 8.53E-20 mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107589818 NA 7.95E-09 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107589818 NA 4.01E-06 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107589818 NA 1.49E-06 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107589818 NA 6.85E-08 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107589818 NA 1.28E-10 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107589818 NA 1.96E-12 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107589818 NA 3.33E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107589818 NA 1.39E-09 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107589818 NA 1.86E-09 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107589818 NA 2.40E-12 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107589818 NA 1.24E-17 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107589818 NA 6.03E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107589818 NA 1.13E-06 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107589818 NA 2.86E-07 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107589818 NA 1.38E-21 mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251