Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1107499796:

Variant ID: vg1107499796 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 7499796
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCAATCTCTTCCTCCATCTACTTGTACGCATGCACTGATACACCGCGTGGTAGAGTTTGCTAGAATTATCTGGAGTCTGTAGTCTGTACAGGTTTAACA[A/G]
GAAGTGAAGGATTTCACACCACTGGCAGAGAAACCATTTTTAGTCGGTCCACCAGATTTCACAATAGTTTCGATTGTATTAAAAATTAAGACTAAAAATA

Reverse complement sequence

TATTTTTAGTCTTAATTTTTAATACAATCGAAACTATTGTGAAATCTGGTGGACCGACTAAAAATGGTTTCTCTGCCAGTGGTGTGAAATCCTTCACTTC[T/C]
TGTTAAACCTGTACAGACTACAGACTCCAGATAATTCTAGCAAACTCTACCACGCGGTGTATCAGTGCATGCGTACAAGTAGATGGAGGAAGAGATTGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.30% 15.70% 0.02% 0.02% NA
All Indica  2759 99.50% 0.40% 0.00% 0.04% NA
All Japonica  1512 58.10% 41.90% 0.00% 0.00% NA
Aus  269 95.90% 4.10% 0.00% 0.00% NA
Indica I  595 99.50% 0.30% 0.00% 0.17% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.70% 1.30% 0.00% 0.00% NA
Temperate Japonica  767 41.10% 58.90% 0.00% 0.00% NA
Tropical Japonica  504 85.10% 14.90% 0.00% 0.00% NA
Japonica Intermediate  241 55.60% 44.40% 0.00% 0.00% NA
VI/Aromatic  96 29.20% 70.80% 0.00% 0.00% NA
Intermediate  90 80.00% 18.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1107499796 A -> DEL N N silent_mutation Average:65.468; most accessible tissue: Zhenshan97 panicle, score: 88.35 N N N N
vg1107499796 A -> G LOC_Os11g13670.1 upstream_gene_variant ; 4335.0bp to feature; MODIFIER silent_mutation Average:65.468; most accessible tissue: Zhenshan97 panicle, score: 88.35 N N N N
vg1107499796 A -> G LOC_Os11g13680.1 downstream_gene_variant ; 2632.0bp to feature; MODIFIER silent_mutation Average:65.468; most accessible tissue: Zhenshan97 panicle, score: 88.35 N N N N
vg1107499796 A -> G LOC_Os11g13670-LOC_Os11g13680 intergenic_region ; MODIFIER silent_mutation Average:65.468; most accessible tissue: Zhenshan97 panicle, score: 88.35 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1107499796 A G -0.02 0.01 0.02 0.02 0.02 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1107499796 5.21E-07 5.21E-07 mr1589 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107499796 2.39E-06 2.39E-06 mr1918 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251