\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1107416561:

Variant ID: vg1107416561 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 7416561
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


TTCACGAATATTGAAATCAAACATAACATGTTACTTTTCGATTTTAAGAGAGCTCTGAACGTCTTTATTTATAGCTGCACTTAGTCAATTTAGATTCCAA[G/A]
TGCATGCAAATATGTTCTGATATCAGTTGAGGTATCCTTGCATGTTCTCTGATTGGGTTGTAGATATGGATTTCAATCTATATTTGTTTGCCACTTGTTT

Reverse complement sequence

AAACAAGTGGCAAACAAATATAGATTGAAATCCATATCTACAACCCAATCAGAGAACATGCAAGGATACCTCAACTGATATCAGAACATATTTGCATGCA[C/T]
TTGGAATCTAAATTGACTAAGTGCAGCTATAAATAAAGACGTTCAGAGCTCTCTTAAAATCGAAAAGTAACATGTTATGTTTGATTTCAATATTCGTGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.20% 6.40% 3.28% 3.11% NA
All Indica  2759 83.70% 10.20% 4.97% 1.16% NA
All Japonica  1512 90.50% 1.10% 1.12% 7.34% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 95.60% 1.20% 2.86% 0.34% NA
Indica II  465 87.50% 3.70% 8.17% 0.65% NA
Indica III  913 73.50% 17.90% 6.02% 2.63% NA
Indica Intermediate  786 84.20% 12.00% 3.44% 0.38% NA
Temperate Japonica  767 97.30% 0.30% 0.39% 2.09% NA
Tropical Japonica  504 86.10% 1.40% 1.59% 10.91% NA
Japonica Intermediate  241 78.00% 2.90% 2.49% 16.60% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 3.30% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1107416561 G -> A LOC_Os11g13520.1 upstream_gene_variant ; 3324.0bp to feature; MODIFIER silent_mutation Average:51.187; most accessible tissue: Zhenshan97 young leaf, score: 69.263 N N N N
vg1107416561 G -> A LOC_Os11g13530.1 downstream_gene_variant ; 3075.0bp to feature; MODIFIER silent_mutation Average:51.187; most accessible tissue: Zhenshan97 young leaf, score: 69.263 N N N N
vg1107416561 G -> A LOC_Os11g13520-LOC_Os11g13530 intergenic_region ; MODIFIER silent_mutation Average:51.187; most accessible tissue: Zhenshan97 young leaf, score: 69.263 N N N N
vg1107416561 G -> DEL N N silent_mutation Average:51.187; most accessible tissue: Zhenshan97 young leaf, score: 69.263 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1107416561 NA 6.00E-06 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107416561 NA 2.08E-06 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107416561 1.42E-06 9.49E-09 mr1247 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251