Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1107416561:

Variant ID: vg1107416561 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 7416561
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:

TTCACGAATATTGAAATCAAACATAACATGTTACTTTTCGATTTTAAGAGAGCTCTGAACGTCTTTATTTATAGCTGCACTTAGTCAATTTAGATTCCAA[G/A]
TGCATGCAAATATGTTCTGATATCAGTTGAGGTATCCTTGCATGTTCTCTGATTGGGTTGTAGATATGGATTTCAATCTATATTTGTTTGCCACTTGTTT

Reverse complement sequence

AAACAAGTGGCAAACAAATATAGATTGAAATCCATATCTACAACCCAATCAGAGAACATGCAAGGATACCTCAACTGATATCAGAACATATTTGCATGCA[C/T]
TTGGAATCTAAATTGACTAAGTGCAGCTATAAATAAAGACGTTCAGAGCTCTCTTAAAATCGAAAAGTAACATGTTATGTTTGATTTCAATATTCGTGAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.20%	6.40%	3.28%	3.11%	NA
All Indica	2759	83.70%	10.20%	4.97%	1.16%	NA
All Japonica	1512	90.50%	1.10%	1.12%	7.34%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	95.60%	1.20%	2.86%	0.34%	NA
Indica II	465	87.50%	3.70%	8.17%	0.65%	NA
Indica III	913	73.50%	17.90%	6.02%	2.63%	NA
Indica Intermediate	786	84.20%	12.00%	3.44%	0.38%	NA
Temperate Japonica	767	97.30%	0.30%	0.39%	2.09%	NA
Tropical Japonica	504	86.10%	1.40%	1.59%	10.91%	NA
Japonica Intermediate	241	78.00%	2.90%	2.49%	16.60%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	3.30%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1107416561	G -> A	LOC_Os11g13520.1	upstream_gene_variant ; 3324.0bp to feature; MODIFIER	silent_mutation	Average:51.187; most accessible tissue: Zhenshan97 young leaf, score: 69.263	N	N	N	N
vg1107416561	G -> A	LOC_Os11g13530.1	downstream_gene_variant ; 3075.0bp to feature; MODIFIER	silent_mutation	Average:51.187; most accessible tissue: Zhenshan97 young leaf, score: 69.263	N	N	N	N
vg1107416561	G -> A	LOC_Os11g13520-LOC_Os11g13530	intergenic_region ; MODIFIER	silent_mutation	Average:51.187; most accessible tissue: Zhenshan97 young leaf, score: 69.263	N	N	N	N
vg1107416561	G -> DEL	N	N	silent_mutation	Average:51.187; most accessible tissue: Zhenshan97 young leaf, score: 69.263	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1107416561	NA	6.00E-06	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107416561	NA	2.08E-06	mr1119	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107416561	1.42E-06	9.49E-09	mr1247	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251