\
| Variant ID: vg1107416561 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 7416561 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 115. )
TTCACGAATATTGAAATCAAACATAACATGTTACTTTTCGATTTTAAGAGAGCTCTGAACGTCTTTATTTATAGCTGCACTTAGTCAATTTAGATTCCAA[G/A]
TGCATGCAAATATGTTCTGATATCAGTTGAGGTATCCTTGCATGTTCTCTGATTGGGTTGTAGATATGGATTTCAATCTATATTTGTTTGCCACTTGTTT
AAACAAGTGGCAAACAAATATAGATTGAAATCCATATCTACAACCCAATCAGAGAACATGCAAGGATACCTCAACTGATATCAGAACATATTTGCATGCA[C/T]
TTGGAATCTAAATTGACTAAGTGCAGCTATAAATAAAGACGTTCAGAGCTCTCTTAAAATCGAAAAGTAACATGTTATGTTTGATTTCAATATTCGTGAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.20% | 6.40% | 3.28% | 3.11% | NA |
| All Indica | 2759 | 83.70% | 10.20% | 4.97% | 1.16% | NA |
| All Japonica | 1512 | 90.50% | 1.10% | 1.12% | 7.34% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.60% | 1.20% | 2.86% | 0.34% | NA |
| Indica II | 465 | 87.50% | 3.70% | 8.17% | 0.65% | NA |
| Indica III | 913 | 73.50% | 17.90% | 6.02% | 2.63% | NA |
| Indica Intermediate | 786 | 84.20% | 12.00% | 3.44% | 0.38% | NA |
| Temperate Japonica | 767 | 97.30% | 0.30% | 0.39% | 2.09% | NA |
| Tropical Japonica | 504 | 86.10% | 1.40% | 1.59% | 10.91% | NA |
| Japonica Intermediate | 241 | 78.00% | 2.90% | 2.49% | 16.60% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 3.30% | 1.11% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1107416561 | G -> A | LOC_Os11g13520.1 | upstream_gene_variant ; 3324.0bp to feature; MODIFIER | silent_mutation | Average:51.187; most accessible tissue: Zhenshan97 young leaf, score: 69.263 | N | N | N | N |
| vg1107416561 | G -> A | LOC_Os11g13530.1 | downstream_gene_variant ; 3075.0bp to feature; MODIFIER | silent_mutation | Average:51.187; most accessible tissue: Zhenshan97 young leaf, score: 69.263 | N | N | N | N |
| vg1107416561 | G -> A | LOC_Os11g13520-LOC_Os11g13530 | intergenic_region ; MODIFIER | silent_mutation | Average:51.187; most accessible tissue: Zhenshan97 young leaf, score: 69.263 | N | N | N | N |
| vg1107416561 | G -> DEL | N | N | silent_mutation | Average:51.187; most accessible tissue: Zhenshan97 young leaf, score: 69.263 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1107416561 | NA | 6.00E-06 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107416561 | NA | 2.08E-06 | mr1119 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107416561 | 1.42E-06 | 9.49E-09 | mr1247 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |